Wszystkie zdjęcia(1)
Kluczowe dokumenty
HSTUD1491
MISSION® Synthetic microRNA Inhibitor, Human
hsa-miR-4484
Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
About This Item
Kod UNSPSC:
12352200
NACRES:
NA.51
linia produktu
MISSION®
Formularz
solid
sekwencja dojrzała
AAAAGGCGGGAGAAGCCCCA
numer dostępu Sanger dla cząsteczek dojrzałych/niedojrzałych
numer dostępu Sanger microRNA
temp. przechowywania
−20°C
Opis ogólny
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Inne uwagi
Based on miRBase V19
Informacje prawne
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.
Hasło ostrzegawcze
Warning
Zwroty wskazujące rodzaj zagrożenia
Zwroty wskazujące środki ostrożności
Klasyfikacja zagrożeń
STOT RE 2 Inhalation
Organy docelowe
Respiratory Tract
Kod klasy składowania
11 - Combustible Solids
Klasa zagrożenia wodnego (WGK)
WGK 3
Temperatura zapłonu (°F)
Not applicable
Temperatura zapłonu (°C)
Not applicable
Wybierz jedną z najnowszych wersji:
Certyfikaty analizy (CoA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.
Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta
Masz już ten produkt?
Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.
Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.
Skontaktuj się z zespołem ds. pomocy technicznej