Zaloguj się, aby wyświetlić ceny organizacyjne i kontraktowe.
Wybierz wielkość
Informacje o tej pozycji
NACRES:
NA.51
UNSPSC Code:
12352200
Pomoc techniczna
Potrzebujesz pomocy? Nasz zespół doświadczonych naukowców chętnie Ci pomoże.
Pozwól nam pomócPomoc techniczna
Potrzebujesz pomocy? Nasz zespół doświadczonych naukowców chętnie Ci pomoże.
Pozwól nam pomócproduct line
MISSION®
form
solid
mature sequence
CACAGGCUUAGAAAAGACAGU
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
General description
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)
Other Notes
Based on miRBase V19
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.
signalword
Warning
hcodes
pcodes
Hazard Classifications
STOT RE 2 Inhalation
target_organs
Respiratory Tract
Klasa składowania
11 - Combustible Solids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Wybierz jedną z najnowszych wersji:
Masz już ten produkt?
Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.
Powiązane treści
Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.
Skontaktuj się z zespołem ds. pomocy technicznej