Przejdź do zawartości
Merck

HSTUD0500

Sigma-Aldrich

MISSION® Synthetic microRNA Inhibitor, Human

hsa-miR-33b-5p

Synonim(y):

hsa-miR-33b

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
12352200
NACRES:
NA.51

linia produktu

MISSION®

Formularz

solid

sekwencja dojrzała

GUGCAUUGCUGUUGCAUUGC

numer dostępu Sanger dla cząsteczek dojrzałych/niedojrzałych

numer dostępu Sanger microRNA

temp. przechowywania

−20°C

Opis ogólny

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

  • Long lasting inhibition at very low dosage
  • Excellent resistance to cellular nucleases
  • Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)

Inne uwagi

Based on miRBase V19

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Piktogramy

Health hazard

Hasło ostrzegawcze

Warning

Zwroty wskazujące rodzaj zagrożenia

Zwroty wskazujące środki ostrożności

Klasyfikacja zagrożeń

STOT RE 2 Inhalation

Organy docelowe

Respiratory Tract

Kod klasy składowania

11 - Combustible Solids

Klasa zagrożenia wodnego (WGK)

WGK 3

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiuxing Wang et al.
Cancer research, 77(18), 4947-4960 (2017-07-22)
Metabolic dysregulation drives tumor initiation in a subset of glioblastomas harboring isocitrate dehydrogenase (IDH) mutations, but metabolic alterations in glioblastomas with wild-type IDH are poorly understood. MYC promotes metabolic reprogramming in cancer, but targeting MYC has proven notoriously challenging. Here

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej