HMI2087
MISSION® microRNA Mimic
hsa-miR-5195-3p
Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
About This Item
linia produktu
MISSION®
Postać
solid
sekwencja dojrzała
AUCCAGUUCUCUGAGGGGGCU
numer dostępu Sanger dla cząsteczek dojrzałych/niedojrzałych
numer dostępu Sanger microRNA
temp. przechowywania
−20°C
informacje o genach
human ... hsa-mir-5195(100847062)
Opis ogólny
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Informacje prawne
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.
Kod klasy składowania
13 - Non Combustible Solids
Klasa zagrożenia wodnego (WGK)
WGK 3
Temperatura zapłonu (°F)
Not applicable
Temperatura zapłonu (°C)
Not applicable
Certyfikaty analizy (CoA)
Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.
Masz już ten produkt?
Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.
Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.
Skontaktuj się z zespołem ds. pomocy technicznej