Zaloguj się, aby wyświetlić ceny organizacyjne i kontraktowe.
Wybierz wielkość
Informacje o tej pozycji
NACRES:
NA.51
UNSPSC Code:
12352200
Pomoc techniczna
Potrzebujesz pomocy? Nasz zespół doświadczonych naukowców chętnie Ci pomoże.
Pozwól nam pomócPomoc techniczna
Potrzebujesz pomocy? Nasz zespół doświadczonych naukowców chętnie Ci pomoże.
Pozwól nam pomócproduct line
MISSION®
form
solid
mature sequence
UACGGUGAGCCUGUCAUUAUUC
Sanger mature/minor accession no.
Sanger microRNA accession no.
storage temp.
−20°C
Gene Information
human ... hsa-mir-433(574037)
General description
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.
Klasa składowania
13 - Non Combustible Solids
wgk
WGK 3
flash_point_f
Not applicable
flash_point_c
Not applicable
Wybierz jedną z najnowszych wersji:
Masz już ten produkt?
Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.
Powiązane treści
Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.
Skontaktuj się z zespołem ds. pomocy technicznej