Wszystkie zdjęcia(1)
Kluczowe dokumenty
HLTUD1491
MISSION® Lenti microRNA Inhibitor, Human
hsa-miR-4484
Synonim(y):
Tough Decoy, TuD
Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
About This Item
Kod UNSPSC:
41106609
NACRES:
NA.51
Poziom jakości
linia produktu
MISSION®
Formularz
liquid
stężenie
≥1x106 VP/ml (via p24 assay)
metody
capture ELISA: 106 TU/mL using p24 (Volume 200 uL)
sekwencja dojrzała
AAAAGGCGGGAGAAGCCCCA
numer dostępu Sanger dla cząsteczek dojrzałych/niedojrzałych
numer dostępu Sanger microRNA
Warunki transportu
dry ice
temp. przechowywania
−70°C
Opis ogólny
Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.
- Allows for potent inhibition of the desired miRNA
- Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
- Enables long-term inhibition without repeat transfection
Inne uwagi
Based on miRBase V19 Mature ID
Informacje prawne
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.
Kod klasy składowania
12 - Non Combustible Liquids
Klasa zagrożenia wodnego (WGK)
WGK 3
Temperatura zapłonu (°F)
Not applicable
Temperatura zapłonu (°C)
Not applicable
Wybierz jedną z najnowszych wersji:
Certyfikaty analizy (CoA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.
Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta
Masz już ten produkt?
Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.
Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.
Skontaktuj się z zespołem ds. pomocy technicznej