HLTUD0230

MISSION^® Lenti microRNA Inhibitor, Human

hsa-miR-146b-5p

• Synonim(y): Tough Decoy, TuD
• Kod UNSPSC: 41106609
• NACRES: NA.51

Właściwości

• linia produktu: MISSION^®
• Postać: liquid
• stężenie: ≥1x10⁶ VP/ml (via p24 assay)
• metody: capture ELISA: 10⁶ TU/mL using p24 (Volume 200 uL)
• sekwencja dojrzała: UGAGAACUGAAUUCCAUAGGCU
• numer dostępu Sanger dla cząsteczek dojrzałych/niedojrzałych: MIMAT0002809
• numer dostępu Sanger microRNA: MI0003129
• Warunki transportu: dry ice
• temp. przechowywania: −70°C

Opis

Opis ogólny

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

• Allows for potent inhibition of the desired miRNA
• Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
• Enables long-term inhibition without repeat transfection

Inne uwagi

Based on miRBase V19 Mature ID

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

This page may contain text that has been machine translated.

Informacja o środkach bezpieczeństwa

• Kod klasy składowania: 12 - Non Combustible Liquids
• Klasa zagrożenia wodnego (WGK): WGK 3
• Temperatura zapłonu (°F): Not applicable
• Temperatura zapłonu (°C): Not applicable