Przejdź do zawartości
Merck

HLMIR1814

Sigma-Aldrich

MISSION® Lenti microRNA, Human

hsa-miR-4753-5p

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41106609
NACRES:
NA.51

Poziom jakości

linia produktu

MISSION®

Formularz

liquid

stężenie

≥1x106 VP/ml (via p24 assay)

sekwencja dojrzała

CAAGGCCAAAGGAAGAGAACAG

numer dostępu Sanger dla cząsteczek dojrzałych/niedojrzałych

numer dostępu Sanger microRNA

Warunki transportu

dry ice

temp. przechowywania

−70°C

Opis ogólny

Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.

Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.

Inne uwagi

Based on miRBase V20 Mature ID

Polecane produkty

Two negative controls are available: NCLMIR001 and NCLMIR002

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

12 - Non Combustible Liquids

Klasa zagrożenia wodnego (WGK)

WGK 3

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej