Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU201271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pcsk6

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGGATTAGCCAAAAGACATCTGATGGCCAGGCAGTTCCATAAACATGCAAAGCCAGCCCCTGAATCACTAGTCGCCAGCCCTCCATGGCACACAACTGCTTTTCAAGTGTATTTGGCCTCTGCACTCGGGACTCTCTGTTCTTGGGTGGATGCTGCGCTGGTCCAGTATGGTACAAGCCTACATGATAGAGCTGGATTGATTTTTCTGCCAAGCCTGTGTGGGCATTTTATAAGCTACGTGTTCTAATTTTTACCGATGTTAATTATTTTGACAAATATTTCATATATTTTCATTGAAATGCGCAAATCCGCTTGCTCAGTTCCCTGAGCTAAGGGAATAACACTTGCCTTAAATTTCCCCAACCTCGTCTCTCTCCACATGGTCCTGCTCTCCTCTCTGACTGTAATGTGTTTGTCTTGTCACCTGTAGGTGGCAAGGACTCAGCTGTTGTCTGTTGAATCCACACTTCAAATAAGAAATCAGTGAAGCAAATCTAATGTTAACCCTGA

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one
Zhiyong Yao et al.
Drug design, development and therapy, 9, 5911-5923 (2015-11-26)
PACE4 is a proprotein convertase capable of processing numerous substrates involved in tumor growth, invasion, and metastasis. However, the precise role of PACE4 during prostate cancer cell apoptosis has not been reported. In the present study, human prostate cancer cell
Huiyu Jiang et al.
Molecular medicine reports, 12(5), 7681-7686 (2015-10-16)
The aim of the present study was to assess the effects of pro-protein convertase subtilisin/kexin type 6 (PCSK6), a proteinase implicated in the proteolytic activity of various precursor proteins and involved in the regulation of protein maturation, in fibroblast‑like synoviocytes

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej