Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU093231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akr1b7

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CACCCTTATCTCACCCAGGAAAAACTGATCCAATACTGTCAATCCAAGGGCATCGCTGTTACAGCCTACAGTCCCCTGGGCTCCCCAGACAGGCCTTATGCCAAGCCAGAAGACCCCGTAGTAATGGAGATTCCCAAGATCAAAGAGATTGCTGCAAAACACAAGAAAACAGTAGCTCAGGTTCTGATTCGGTTCCATGTCCAAAGGAATGTGGTGGTGATCCCCAAGTCTGTGACACCCTCACGCATACAGGAGAACCTGCAGGTCTTCGACTTCCAGTTGAGTGAGGAGGACATGGCTGCCATTCTCAGCTTCAACAGGAACTGGAGGGCCTGTGACCTGTTGGATGCAAGGACTGAAGAGGACTATCCTTTCCACGAGGAATACTGAGGTCCACTTGCTTGATGAGATCCGTGCATGAT

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

3355 esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Stanowią one heterogeniczną mieszaninę siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także wyświetlić wszystkie dostępne opcje esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Tao Shan et al.
Cancer science, 105(7), 847-856 (2014-05-13)
Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal
Xianwei Li et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 19(5), 401-411 (2015-09-04)
Aldose reductase (AR) is known to play a crucial role in the mediation of diabetic and cardiovascular complications. Recently, several studies have demonstrated that allergen-induced airway remodeling and ovalbumin-induced asthma is mediated by AR. Epalrestat is an aldose reductase inhibitor
Xiaolong Du et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1472-1479 (2015-05-15)
Angiogenesis is critical to wound repair due to its role in providing oxygen and nutrients that are required to support the growth and function of reparative cells in damaged tissues. Adenosine receptors are claimed to be of paramount importance in

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej