Przejdź do zawartości
Merck

EMU091061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rbpj

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCTATGGCAACAGCGATGACATTGGTGTGTTCCTCAGCAAGCGGATAAAGGTCATCTCCAAACCCTCCAAAAAGAAGCAGTCACTGAAGAATGCTGACTTGTGCATTGCTTCAGGAACGAAGGTGGCACTGTTCAATCGCCTTCGGTCCCAGACAGTTAGTACCAGGTACCTGCATGTAGAAGGAGGGAATTTCCACGCCAGTTCACAACAGTGGGGAGCATTTTACATCCATCTCTTGGACGACGACGAGTCGGAAGGAGAGGAGTTCACAGTTAGAGATGGCTACATCCATTACGGGCAGACTGTCAAGCTTGTGTGCTCAGTGACTGGCATGGCACTCCCAAGATTGATAATTAGGAAAGTTGATAAGCAGACGGCATTACTGGATGCAGACGACCCTGTAT

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

12 - Non Combustible Liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

M Tanaka et al.
British journal of cancer, 100(12), 1957-1965 (2009-05-21)
The study shows constitutive activation of the Notch pathway in various types of malignancies. However, it remains unclear how the Notch pathway is involved in the pathogenesis of osteosarcoma. We investigated the expression of the Notch pathway molecules in osteosarcoma
Hideya Onishi et al.
Cancer letters, 371(2), 143-150 (2015-12-15)
We previously demonstrated that Hedgehog (Hh) signaling is activated under hypoxia through upregulation of transcription of Smoothened (SMO) gene. However, the mechanism of hypoxia-induced activation of SMO transcription remains unclear. In the analysis of altered expressions of genes related to
Hiroko Nagao et al.
PloS one, 7(7), e39268-e39268 (2012-07-14)
The Notch pathway regulates a broad spectrum of cell fate decisions and differentiation processes during fetal and postnatal development. In addition, the Notch pathway plays an important role in controlling tumorigenesis. However, the role of RBPJ, a transcription factor in
Hirokuni Akahori et al.
Nature communications, 6, 7792-7792 (2015-08-06)
Macrophages are an essential component of the immune response to ischaemic injury and play an important role in promoting inflammation and its resolution, which is necessary for tissue repair. The type I transmembrane glycoprotein CD163 is exclusively expressed on macrophages
Robert J Lake et al.
PLoS genetics, 10(3), e1004204-e1004204 (2014-03-08)
Mechanisms that maintain transcriptional memory through cell division are important to maintain cell identity, and sequence-specific transcription factors that remain associated with mitotic chromatin are emerging as key players in transcriptional memory propagation. Here, we show that the major transcriptional

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej