Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EMU066761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fyb

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATGCCTCAGACTTCCCTCCTCCACCTGCAGAGATGAGTCAAGGAATGAGTGTTGGAAGGGCAAAAACGGAAGAGAAAGATCCCAAGAAGCTAAAAAAGCAAGAAAAGGAAGAAAAAGACCTCAGGAAAAAATTTAAGTACGACGGTGAAATTCGAGTTCTATATTCAACTAAAGTTGCGTCCTCCTTAACCTCTAAAAAGTGGGGAGCGAGAGATCTGCAGATAAAACCTGGGGAGTCACTCGAAGTTATACAAAGCACAGATGACACCAAAGTTCTCTGCAGGAATGAAGAGGGCAAATATGGTTATGTCCTTCGGAGTTACCTGGTGGACAATGATGGAGAAATCTATGACGACATCGCTGATGGTTGCATCTATGACAATGACTAGCACTCTGCTCTGTTCATTCCACTGTGCC

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000022148

numer dostępu NCBI

NM_011815

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... FYB(23880) , Fyb(23880)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Mahmoud A Chawsheen et al.
Cellular signalling, 81, 109934-109934 (2021-02-06)
Lung cancer has a poor prognosis partly due to a lack of response to treatments such as the chemotherapy drug gemcitabine. Combinations of chemotherapy drugs with signal transduction inhibitors may be more effective treatments. In this study we have investigated
Fang Wang et al.
Folia histochemica et cytobiologica, 58(2), 96-107 (2020-06-27)
Growing evidence indicates that Rictor (Rapamycin-insensitive companion of mTOR) is overexpressed across several malignancies and associated with poor survival. However, only limited data indicate that Rictor plays a role in gastric cancer (GC). We sought to explore the prognostic value
Li Feng et al.
Pharmaceutical biology, 57(1), 586-594 (2019-09-08)
Context: Evidence suggests that microRNA (miRNA) regulate gene expression and bone tissue homoeostasis of osteoporosis. MiR-152 has found to be abnormally expressed in osteoporosis, but its role in osteoblast differentiation has not been elucidated. Objective: To understand the potential mechanism
Zhaoming Lu et al.
Acta pharmaceutica Sinica. B, 10(6), 1004-1019 (2020-07-10)
Dysregulation of mTORC1/mTORC2 pathway is observed in many cancers and mTORC1 inhibitors have been used clinically in many tumor types; however, the mechanism of mTORC2 in tumorigenesis is still obscure. Here, we mainly explored the potential role of mTORC2 in
Zheng Guo et al.
Oncology reports, 45(2), 523-534 (2021-01-09)
Colorectal cancer (CRC) is a common cancer worldwide, and its treatment strategies are limited. The underlying mechanism of CRC progression remains to be determined. Telomere maintenance 2 (TELO2) is a mTOR‑interacting protein. Both the role and molecular mechanism of TELO2 in cancer
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej