Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU061651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccne1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GATGGAGGTGTGCGAAGTCTATAAGCTCCACAGAGAGACGTTCTACTTGGCACAGGACTTCTTTGATCGTTACATGGCATCACAACAGAATATCATAAAAACACTTTTACAGCTTATTGGGATTTCAGCCTTATTTATTGCTTCAAAACTTGAGGAAATCTACCCTCCAAAGTTGCACCAGTTTGCTTATGTTACAGATGGCGCTTGCTCCGGGGATGAAATTCTTACCATGGAATTGATGATGATGAAGGCCCTTAAGTGGCGTCTAAGCCCTCTGACCATTGTGTCCTGGCTGAATGTCTATGTCCAAGTGGCCTATGTCAACGACACGGGTGAGGTGCTGATGCCTCAGTACCCACAGCAGGTCTTCGTGCAGATCGCAGAGCTTCTAGACCTGTGCGTCC

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000002068

numer dostępu NCBI

NM_007633

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... CCNE1(12447) , Ccne1(12447)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Zhiyuan Han et al.
Oncotarget, 6(15), 13149-13163 (2015-04-25)
Cyclin E1, encoded by the CCNE1 gene, promotes G1/S transition, chromosome instability, and oncogenesis. Here, we show that miR-497 and miR-34a target the 3'-UTR of CCNE1. miR-497 and miR-34a are downregulated in cancer cells and their ectopic expression inhibited cell
Xiaoyang Xu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(2), 419-431 (2015-09-01)
The accumulation of free cholesterol in atherosclerotic lesions has been well documented in both animals and humans. In studying the relevance of free cholesterol buildup in atherosclerosis, contradictory results have been generated, indicating that free cholesterol produces both pro- and
Ning-Ai Liu et al.
The Journal of clinical endocrinology and metabolism, 100(7), 2557-2564 (2015-05-06)
Cushing disease, due to pituitary corticotroph tumor ACTH hypersecretion, drives excess adrenal cortisol production with adverse morbidity and mortality. Loss of glucocorticoid negative feedback on the hypothalamic-pituitary-adrenal axis leads to autonomous transcription of the corticotroph precursor hormone proopiomelanocortin (POMC), consequent

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej