Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EMU055771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Aurkb

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCCAGAAGTTGGCTGAGAACAAGAGTCAGGGCTCCACTGCCTCGCAAGGATCCCAGAACAAGCAGCCTTTCACTATTGACAACTTTGAGATTGGGCGTCCTTTGGGCAAAGGCAAATTTGGAAACGTGTACTTGGCTCGGGAGAAGAAGAGCCGTTTCATCGTGGCACTCAAGATCCTCTTCAAGTCTCAGATTGAGAAGGAGGGGGTAGAGCACCAGCTTCGCCGAGAGATCGAAATCCAGGCGCACCTGAAACATCCCAACATCCTTCAACTCTACAACTACTTCTACGACCAGCAGAGGATCTACTTAATCCTGGAATACGCCCCTCGCGGGGAACTCTACAAGGAACTGCAGAAGAGTCGGACCTTCGATGAGCAGCGGACTGCCACGATCATGGAGGAACTGTCAGATGCCCTGACCTACTGCCACAAGAAGAAGGTAATTCACAGAGACATAAAGCCGGAGAACCTGCTGTTAGGTCTGCAGGGAG

Ensembl | numer dostępu dla gatunku mysz

ENSMUSG00000020897

numer dostępu NCBI

NP_035626

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

mouse ... AURKB(20877) , Aurkb(20877)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Antonio Madejón et al.
Journal of hepatology, 63(2), 312-319 (2015-03-04)
Chronic hepatitis C is a leading cause of chronic liver disease, cirrhosis and hepatocellular carcinoma. DNA methylation and histone covalent modifications constitute crucial mechanisms of genomic instability in human disease, including liver fibrosis and hepatocellular carcinoma. The present work studies
Kazuharu Kai et al.
Molecular cancer therapeutics, 14(12), 2687-2699 (2015-10-08)
Currently, no targeted drug is available for triple-negative breast cancer (TNBC), an aggressive breast cancer that does not express estrogen receptor, progesterone receptor, or HER2. TNBC has high mitotic activity, and, because Aurora A and B mitotic kinases drive cell
Lijuan Zhu et al.
The Journal of biological chemistry, 290(45), 27053-27066 (2015-09-18)
Mitotic chromosome segregation is orchestrated by the dynamic interaction of spindle microtubules with the kinetochores. During chromosome alignment, kinetochore-bound microtubules undergo dynamic cycles between growth and shrinkage, leading to an oscillatory movement of chromosomes along the spindle axis. Although kinetochore
Aarthi Jayanthan et al.
PloS one, 9(7), e102741-e102741 (2014-07-23)
Leukemia is the most common pediatric malignancy, constituting more than 30% of all childhood cancers. Although cure rates have improved greatly, approximately one in five children relapse and poor survival rates post relapse remain a challenge. Given this, more effective

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej