Przejdź do zawartości
Merck

EMU052411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdc42

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTGTTGGTGATGGTGCTGTTGGTAAAACATGTCTCCTGATATCCTACACAACAAACAAATTCCCATCGGAATATGTACCAACTGTTTTTGACAACTATGCAGTCACAGTTATGATTGGTGGAGAGCCATACACTCTTGGACTTTTTGATACTGCAGGGCAAGAGGATTATGACAGACTACGACCGCTAAGTTATCCACAGACAGATGTTTTTCTAGTATGTTTCTCAGTGGTCTCTCCATCCTCATTTGAAAATGTGAAAGAAAAGTGGGTGCCTGAGATAACTCACCACTGTCCAAAGACTCCTTTCTTGCTTGTTGGGACCCAAATTGATCTCAGAGATGACCCCTCTACTATTGAGAAACTTGCCAAGAACAAACAGAAGCCTATTACTCCAGAGACTGCTGAAAAGCTGGCGCGGGATCTGAAGGCTGTCAAGTATGTGGAGTGCTCCGC

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Laurent Pieuchot et al.
Nature communications, 9(1), 3995-3995 (2018-09-30)
Cells have evolved multiple mechanisms to apprehend and adapt finely to their environment. Here we report a new cellular ability, which we term "curvotaxis" that enables the cells to respond to cell-scale curvature variations, a ubiquitous trait of cellular biotopes.
Shayoni Ray et al.
Molecular biology of the cell, 25(16), 2393-2407 (2014-06-27)
Coordinated actin microfilament and microtubule dynamics is required for salivary gland development, although the mechanisms by which they contribute to branching morphogenesis are not defined. Because LIM kinase (LIMK) regulates both actin and microtubule organization, we investigated the role of
Tilman D Rachner et al.
Breast cancer research : BCR, 16(1), R20-R20 (2014-02-18)
Amino-bisphosphonates and statins inhibit the mevalonate pathway, and may exert anti-tumor effects. The Wnt inhibitor dickkopf-1 (DKK-1) promotes osteolytic bone lesions by inhibiting osteoblast functions and has been implicated as an adverse marker in multiple cancers. We assessed the effects

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej