Przejdź do zawartości
Merck

EMU025631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Areg

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGGCAGTGAACTCTCCACAGGGGACTACGACTACTCAGAGGAGTATGATAATGAACCACAAATATCCGGCTATATTATAGATGATTCAGTCAGAGTTGAACAGGTGATTAAGCCCAAGAAAAACAAGACAGAAGGAGAAAAGTCTACAGAAAAACCCAAAAGGAAGAAAAAGGGAGGCAAAAATGGAAAAGGCAGAAGGAATAAGAAGAAAAAGAATCCATGCACTGCCAAGTTTCAGAACTTTTGCATTCATGGCGAATGCAGATACATCGAGAACCTGGAGGTGGTGACATGCAATTGTCATCAAGATTACTTTGGTGAACGGTGTGGAGAAAAATCCATGAAGACTCACAGCGAGGATGACAAGGACCTATCCAAGATTGCAGTAGTAGCTGTCACTATCTTTGTCTCTGCCATCATCCTCGCAGCTATTGGCATCGGCATCGTTATCACAG

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Xiaolong Du et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1472-1479 (2015-05-15)
Angiogenesis is critical to wound repair due to its role in providing oxygen and nutrients that are required to support the growth and function of reparative cells in damaged tissues. Adenosine receptors are claimed to be of paramount importance in
Xianwei Li et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 19(5), 401-411 (2015-09-04)
Aldose reductase (AR) is known to play a crucial role in the mediation of diabetic and cardiovascular complications. Recently, several studies have demonstrated that allergen-induced airway remodeling and ovalbumin-induced asthma is mediated by AR. Epalrestat is an aldose reductase inhibitor
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Tao Shan et al.
Cancer science, 105(7), 847-856 (2014-05-13)
Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej