Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU022801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ctgf

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCAGGAAGTAAGGGACACGAACTCATTAGACTATAACTTGAACTGAGTTGCATCTCATTTTCTTCTGTAAAAACAATTACAGTAGCACATTAATTTAAATCTGTGTTTTTAACTACCGTGGGAGGAACTATCCCACCAAAGTGAGAACGTTATGTCATGGCCATACAAGTAGTCTGTCAACCTCAGACACTGGTTTCGAGACAGTTTACACTTGACAGTTGTTCATTAGCGCACAGTGCCAGAACGCACACTGAGGTGAGTCTCCTGGAACAGTGGAGATGCCAGGAGAAAGAAAGACAGGTACTAGCTGAGGTTATTTTAAAAGCAGCAGTGTGCCTACTTTTTGGAGTGTAACCGGGGAGGGAAATTATAGCATGCTTGCAGACAGACCTGCTCTAGCGAGAGCTGAGCATGTGTCCTCCACTAGATGAGGCTGAGTCCAGCTGT

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

James Hutchenreuther et al.
The Journal of investigative dermatology, 135(11), 2805-2813 (2015-07-15)
Metastatic melanoma has an extremely poor prognosis with few durable remissions. The secreted matricellular protein connective tissue growth factor (CCN2) is overexpressed in cancers including melanoma and may represent a viable therapeutic target. However, the mechanism underlying the contribution of
Tian Tian et al.
American journal of cancer research, 5(5), 1823-1830 (2015-07-16)
Glioblastoma multiforme (GBM) is the deadliest and most common form of malignant primary brain tumor in humans. However, until now, little is known about the glioma genesis and progression at the molecular level. Here we report that overexpression of sine
Chien-Huang Lin et al.
PloS one, 9(8), e104746-e104746 (2014-08-15)
CXCL12 (stromal cell-derived factor-1, SDF-1) is a potent chemokine for homing of CXCR4+ fibrocytes to injury sites of lung tissue, which contributes to pulmonary fibrosis. Overexpression of connective tissue growth factor (CTGF) plays a critical role in pulmonary fibrosis. In
Yunzhuo Ren et al.
Drug design, development and therapy, 9, 4155-4171 (2015-08-11)
Transforming growth factor-β1 (TGF-β1) plays an important role in the pathogenesis and progression of chronic kidney disease. Connective tissue growth factor (CTGF) is a critical fibrogenic mediator of TGF-β1. Mammalian sirtuin 1 (Sirt1) is reported to attenuate renal fibrosis by

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej