Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EMU018761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Furin

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGAGCCAAGAGGGACGTGTATCAGGAGCCCACGGACCCCAAGTTCCCCCAGCAGTGGTACCTGTCTGGTGTCACTCAGCGAGACCTGAATGTGAAGGAGGCCTGGGCCCAGGGCTTCACAGGCCATGGCATTGTGGTCTCCATCCTGGATGACGGCATTGAGAAGAATCATCCCGACCTAGCAGGCAATTATGACCCTGGAGCCAGTTTTGACGTGAATGACCAGGACCCCGACCCACAGCCTCGGTACACACAGATGAATGACAACAGGCATGGCACTCGCTGTGCCGGGGAAGTGGCAGCAGTGGCCAACAATGGTGTCTGTGGCGTAGGTGTAGCTTACAATGCCCGAATTGGAGGGGTGCGGATGTTGGATGGCGAGGTGACTGATGCAGTAGAGGCACGTTCGCTGGGCCTGAATCCCAACCACATCCACAT

Ensembl | numer dostępu dla gatunku mysz

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Diana Farhat et al.
British journal of cancer, 122(6), 885-894 (2020-01-29)
Breast cancer is the second most common cancer in the world. Despite advances in therapies, the mechanisms of resistance remain the underlying cause of morbidity and mortality. Lipoic acid (LA) is an antioxidant and essential cofactor in oxidative metabolism. Its
Z Zhou et al.
Cell death & disease, 4, e593-e593 (2013-04-20)
The multinucleated syncytial trophoblast, which forms the outermost layer of the placenta and serves multiple functions, is differentiated from and maintained by cytotrophoblast cell fusion. Deficiencies in syncytial trophoblast differentiation or maintenance likely contribute to intrauterine growth restriction and pre-eclampsia
Xiaokui Yang et al.
PloS one, 8(2), e50479-e50479 (2013-02-19)
Folliculogenesis is tightly controlled by a series of hormones, growth factors and cytokines, many of which are secreted as proproteins and require processing by proteases before becoming functional. Furin is a member of the subtilisin-like proteases that activate large numbers
Jian Shang et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(21), 11727-11734 (2020-05-08)
A novel severe acute respiratory syndrome (SARS)-like coronavirus (SARS-CoV-2) is causing the global coronavirus disease 2019 (COVID-19) pandemic. Understanding how SARS-CoV-2 enters human cells is a high priority for deciphering its mystery and curbing its spread. A virus surface spike
Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej