Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU218531

Sigma-Aldrich

MISSION® esiRNA

targeting human GPX1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CGCCAAGAACGAAGAGATTCTGAATTCCCTCAAGTACGTCCGGCCTGGTGGTGGGTTCGAGCCCAACTTCATGCTCTTCGAGAAGTGCGAGGTGAACGGTGCGGGGGCGCACCCTCTCTTCGCCTTCCTGCGGGAGGCCCTGCCAGCTCCCAGCGACGACGCCACCGCGCTTATGACCGACCCCAAGCTCATCACCTGGTCTCCGGTGTGTCGCAACGATGTTGCCTGGAACTTTGAGAAGTTCCTGGTGGGCCCTGACGGTGTGCCCCTACGCAGGTACAGCCGCCGCTTCCAGACCATTGACATCGAGCCTGACATCGAAGCCCTGCTGTCTCAAGGGCCCAGCTGTGCCTAGGGCGCCCCTCCTACCCCGGCTGCTTGGCAGTTGCAGTGCTGCTGTCTCGGGGGGGTTTTCATCTATGAGGGTGTTTCCTCTAAACCTACGAGGGAGGAACACCTGATCTTACAGAAAATACCACCTCGAGATGGGTGCTGGTCCTGTTGATCCCAGT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000233276

numer dostępu NCBI

NM_000581

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... GPX1(2876) , GPX1(2876)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
JLU
WJU
YEU
JXT
OUT

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Zhiquan Huang et al.
International journal of oncology, 48(3), 1271-1279 (2016-01-20)
1,25-Dihydroxyvitamin D3 (1,25D3) is the active form of vitamin D with antineoplastic effects. The glutathione peroxidase-1 (GPX1) gene is associated with tumour progression. The present study aimed to explore the role of GPX1 in 1,25D3-mediated progression of salivary adenoid cystic
Yongmin Yan et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 25(2), 465-479 (2017-01-17)
Exosomes are small biological membrane vesicles secreted by various cells, including mesenchymal stem cells (MSCs). We previously reported that MSC-derived exosomes (MSC-Ex) can elicit hepatoprotective effects against toxicant-induced injury. However, the success of MSC-Ex-based therapy for treatment of liver diseases
Yukari Nakano et al.
Metallomics : integrated biometal science, 12(11), 1693-1701 (2020-09-15)
Excessive zinc ion (Zn2+) release is induced in pathological situations and causes neuronal cell death. Previously, we have reported that copper ions (Cu2+) markedly exacerbated Zn2+-induced neuronal cell death by potentiating oxidative stress, the endoplasmic reticulum (ER) stress response, and
Xiangfeng Gan et al.
International journal of clinical and experimental medicine, 7(9), 2530-2540 (2014-10-31)
Esophageal cancer is one of the most common cancers worldwide. Despite recent progress in the development of novel therapies, esophageal carcinoma remains an aggressive cancer associated with a poor prognosis. The glutathione peroxidase 1 (GPX1) gene located on chromosome 3p21.3
Sui Peng et al.
American journal of physiology. Gastrointestinal and liver physiology, 307(2), G129-G139 (2014-05-24)
Hydrophobic bile acids like deoxycholic acid (DCA), which cause oxidative DNA damage and activate NF-κB in Barrett's metaplasia, might contribute to carcinogenesis in Barrett's esophagus. We have explored mechanisms whereby ursodeoxycholic acid (UDCA, a hydrophilic bile acid) protects against DCA-induced

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej