Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU159851

Sigma-Aldrich

MISSION® esiRNA

targeting human CD209

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGGTCCCCAGCTCCATAAGTCAGGAACAATCCAGGCAAGACGCGATCTACCAGAACCTGACCCAGCTTAAAGCTGCAGTGGGTGAGCTCTCAGAGAAATCCAAGCTGCAGGAGATCTACCAGGAGCTGACCCAGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAGGAGATCTACCAGGAGCTGACCCGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGCTGCAGGAGATCTACCAGGAGCTGACCTGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGAAATCTAAGATGCAGGAGATCTACCAGGAGCTGACTCGGCTGAAGGCTGCAGTGGGTGAGCTTCCAGAGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000090659

numer dostępu NCBI

NM_001144893

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CD209(30835) , CD209(30835)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
ZHU
JLS
HIS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

D Feng et al.
Clinical and experimental immunology, 191(1), 107-115 (2017-09-13)
In the pathological process of acute kidney injury (AKI), innate immune receptors are essential in inflammatory response modulation; however, the precise molecular mechanisms are still unclear. Our study sought to demonstrate the inflammatory response mechanisms in renal tubular epithelial cells
Yanmei Jiang et al.
PloS one, 9(12), e114748-e114748 (2014-12-17)
Colon cancer has always been diagnosed at a late stage, which is associated with poor prognosis. The currently used serum tumor markers CEA and CA19-9 display low sensitivity and specificity and may not have diagnostic value in early stage colon
Jian Wu et al.
Frontiers in immunology, 9, 1847-1847 (2018-08-29)
By shaping T cell immunity, tolerogenic dendritic cells (tDCs) play critical roles in the induction of immune tolerance after transplantation. However, the role of long noncoding RNAs (lncRNAs) in the function and immune tolerance of dendritic cells (DCs) is largely
Zoltan Beck et al.
PloS one, 8(11), e81002-e81002 (2013-11-28)
Chronic HIV-1 infection is associated with persistent viremia in most patients, but it remains unclear how free virus may survive the potential hostile effects of plasma. We investigated whether sites might exist on the surfaces of circulating blood cells for
Aiping Liu et al.
PloS one, 9(1), e85176-e85176 (2014-01-24)
Ex vivo foreskin models have demonstrated that inner foreskin is more susceptible to HIV-1 infection than outer foreskin. In the present study we characterized the compartition of HIV-1 target cells and quantified these cells in the epidermis and dermis of
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej