Przejdź do zawartości
Merck

EHU157831

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX6

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGCGTTCTGTCATCTCAGCAAAGAATGGAATCAGAGAATAATAAGTTATGTTCCCTATATTCCTTCCGAAATACCTCTACCTCACCACATAAGCCTGACGAAGGGAGTCGGGACCGTGAGATAATGACCAGTGTTACTTTTGGAACCCCAGAGCGCCGCAAAGGGAGTCTTGCCGATGTGGTGGACACACTGAAACAGAAGAAGCTTGAGGAAATGACTCGGACTGAACAAGAGGATTCCTCCTGCATGGAAAAACTACTTTCAAAAGATTGGAAGGAAAAAATGGAAAGACTAAATACCAGTGAACTTCTTGGAGAAATTAAAGGTACACCTGAGAGCCTGGCAGAAAAAGAACGGCAGCTCTCCACCATGATTACCCAGCTGATCAGTTTACGGGAGCAGCTACTGG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

W-W Xu et al.
European review for medical and pharmacological sciences, 24(8), 4070-4079 (2020-05-07)
Fragile fracture patients need to be treated with long-term fixation and the recovery process is slow. Several studies have shown that the fracture healing process is related to gene expression. We aimed to investigate the role of long chain non-coding
Shifeng Long et al.
Experimental and therapeutic medicine, 17(6), 4741-4747 (2019-05-21)
Increasing evidence has revealed that microRNAs (miRNAs) are closely associated with multiple myeloma (MM) pathogenesis and progression. Therefore, an in-depth understanding of the biological functions of miRNAs in MM may be helpful for the identification of promising therapeutic techniques for
Aruna Marchetto et al.
Nature communications, 11(1), 2423-2423 (2020-05-18)
Ewing sarcoma (EwS) is an aggressive childhood cancer likely originating from mesenchymal stem cells or osteo-chondrogenic progenitors. It is characterized by fusion oncoproteins involving EWSR1 and variable members of the ETS-family of transcription factors (in 85% FLI1). EWSR1-FLI1 can induce

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej