Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU156971

Sigma-Aldrich

MISSION® esiRNA

targeting human ERCC1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CGAATATGCCATCTCACAGCCTCTGGAAGGGGCTGGGGCCACGTGCCCCACAGGGTCAGAGCCCCTGGCAGGAGAGACGCCCAACCAGGCCCTGAAACCCGGGGCAAAATCCAACAGCATCATTGTGAGCCCTCGGCAGAGGGGCAATCCCGTACTGAAGTTCGTGCGCAATGTGCCCTGGGAATTTGGCGACGTAATTCCCGACTATGTGCTGGGCCAGAGCACCTGTGCCCTGTTCCTCAGCCTCCGCTACCACAACCTGCACCCAGACTACATCCATGGGCGGCTGCAGAGCCTGGGGAAGAACTTCGCCTTGCGGGTCCTGCTTGTCCAGGTGGATGTGAAAGATCCCCAGCAGGCCCTCAAGGAGCTGGCTAAGATGTGTATCCTGGCCGACTGCACATTGATCCTCGCCTGGAGCCCCGAGGAAGCTGGGCGGTACCTGGAGACCTACAAGGCCTATGAGCAGAAACCAGC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000012061

numer dostępu NCBI

NM_001983

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ERCC1(2067) , ERCC1(2067)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Wei-Ping Lee et al.
Biochimica et biophysica acta, 1863(4), 917-928 (2017-01-16)
Gemcitabine and capecitabine are two effective anticancer agents against solid tumors. The pharmacological mechanisms have been known as incorporation into DNA and thereby inhibition of DNA synthesis. When used as metronomic chemotherapy, they may inhibit angiogenesis and induce immunity. In
Jae Joon Han et al.
Cancer research and treatment : official journal of Korean Cancer Association, 46(1), 55-64 (2014-02-13)
The novel heat shock protein tumor necrosis factor receptor-associated protein 1 (TRAP1) is associated with multidrug resistance in colorectal cancer (CRC) cells in vitro. Excision repair cross-complementation group 1 (ERCC1) expression levels in tumor tissues also predict clinical outcomes in
Daniel P Feldmann et al.
Molecules (Basel, Switzerland), 25(8) (2020-04-30)
Platinum-based chemotherapy remains a mainstay treatment for the management of advanced non-small cell lung cancer. A key cellular factor that contributes to sensitivity to platinums is the 5'-3' structure-specific endonuclease excision repair cross-complementation group 1 (ERCC1)/ xeroderma pigmentosum group F
Gianmaria Liccardi et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(13), 3496-3506 (2014-05-02)
The epidermal growth factor receptor (EGFR) plays an important role in cellular response to chemotherapy and radiotherapy through modulation of DNA repair. EGFR activates DNA-dependent protein kinase (DNA-PK) stimulating repair of DNA strand breaks (SB) and interstrand crosslinks (ICL). We
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej