Przejdź do zawartości
Merck

EHU154771

Sigma-Aldrich

MISSION® esiRNA

targeting human SLCO2A1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGCTGCAGATCTTTGTGGACTATGGCAGGGTCAACACAGCTGCAGTTAACTTGGTCCCGGGTGACCCCCGATGGATTGGAGCCTGGTGGCTAGGCCTGCTCATTTCTTCAGCTTTATTGGTTCTCACCTCTTTCCCCTTTTTTTTCTTCCCTCGAGCAATGCCCATAGGAGCAAAGAGGGCTCCTGCCACAGCAGATGAAGCAAGGAAGTTGGAGGAGGCCAAGTCAAGAGGCTCCCTGGTGGATTTCATTAAACGGTTTCCATGCATCTTTCTGAGGCTCCTGATGAACTCACTCTTCGTCCTGGTGGTCCTGGCCCAGTGCACCTTCTCCTCCGTCATTGCTGGCCTCTCCACCTTCCTCAACAAGTTCCTGGAGAAGCAGTATGGCACCTCAGCAGCCTATGCCAACTTCCTCATTGGTGCT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ahmad Yasser Hamdi Nor Azlan et al.
Saudi pharmaceutical journal : SPJ : the official publication of the Saudi Pharmaceutical Society, 28(11), 1420-1430 (2020-12-01)
Diabetic wounds are difficult to treat due to multiple causes, including reduced blood flow and bacterial infections. Reduced blood flow is associated with overexpression of prostaglandin transporter (PGT) gene, induced by hyperglycaemia which causing poor vascularization and healing of the
Antonio Madrigal-Martínez et al.
Journal of cellular physiology, 234(5), 7548-7559 (2018-10-28)
Cyclooxygenase (COX)-derived prostaglandin E2 (PGE2 ) affects many mechanisms that have been shown to play roles in carcinogenesis. Recently, we found that, in androgen-independent prostate cancer PC3 cells, PGE2 acts through an intracrine mechanism by which its uptake by the
Zhongbo Liu et al.
PloS one, 10(7), e0133615-e0133615 (2015-08-01)
Peripheral ischemia, resulting from diminished arterial flow and defective local vascularization, is one of the main causes of impaired wound healing in diabetes. Vasodilatory prostaglandins (PGs), including PGE2 and PGI2, regulate blood flow in peripheral tissues. PGs also stimulate angiogenesis

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej