Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU153211

Sigma-Aldrich

MISSION® esiRNA

targeting human TUBB3, RP11-566K11.2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CATTCTGGTGGACCTGGAACCCGGAACCATGGACAGTGTCCGCTCAGGGGCCTTTGGACATCTCTTCAGGCCTGACAATTTCATCTTTGGTCAGAGTGGGGCCGGCAACAACTGGGCCAAGGGTCACTACACGGAGGGGGCGGAGCTGGTGGATTCGGTCCTGGATGTGGTGCGGAAGGAGTGTGAAAACTGCGACTGCCTGCAGGGCTTCCAGCTGACCCACTCGCTGGGGGGCGGCACGGGCTCCGGCATGGGCACGTTGCTCATCAGCAAGGTGCGTGAGGAGTATCCCGACCGCATCATGAACACCTTCAGCGTCGTGCCCTCACCCAAGGTGTCAGACACGGTGGTGGAGCCCTACAACGCCACGCTGTCCATCCACCAGCTGGTGGAGAACACGGATGAGACCTACTGCATCGACAACGAG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000198211
ENSG00000258947

numer dostępu NCBI

NM_001197181
NM_006086

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TUBB3(10381) , TUBB3(10381)

Powiązane kategorie

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Sidika Öztop et al.
Anticancer research, 39(2), 655-662 (2019-02-04)
The challenges of cololorectal cancer (CRC) management include prediction of outcome and drug response or chemoresistance. This study aimed at examining whether βIII-tubulin (TUBB3), present in various types of normal tissues and cancer, is a biomarker for the response of
Yohei Sekino et al.
Anticancer research, 40(4), 1943-1951 (2020-04-03)
Targeted receptor tyrosine kinase inhibitor (TKI) is a standard treatment in advanced renal cell carcinoma (RCC). However, the role of PTEN in TKI resistance remains poorly understood. We aimed to determine the functional role of PTEN knockout and analyse the
Yohei Sekino et al.
Oncology, 98(10), 689-698 (2020-06-26)
βIII-Tubulin, encoded by the TUBB3 gene, is a microtubule protein. Several studies have shown that overexpression of TUBB3 is linked to poor prognosis and is involved in taxane resistance in some cancers. The aim of this study was to analyze
Mihoko A Tame et al.
Oncotarget, 8(42), 71536-71547 (2017-10-27)
Microtubules are cellular targets for a variety of anticancer therapies because of their critical function in mitosis. Taxol belongs to a class of microtubule targeting agents that suppresses microtubule dynamics and interferes with the functioning of the mitotic spindle, thereby
Qian Liu et al.
Aging, 12(4), 3713-3729 (2020-02-29)
P-glycoprotein (P-gp) and βIII-tubulin overexpression-mediated drug resistance leads to clinical therapy failure for paclitaxel. However, the development of paclitaxel-resistance reversal agents has not had much success. In this study, EM-E-11-4, a lathyrane-type diterpenoid extracted from Euphorbia micractina, demonstrated good anti-MDR

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej