Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU145981

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL11A

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCCTTCAGGACTAGGTGCAGAATGTCCTTCCCAGCCACCTCTCCATGGGATTCATATTGCAGACAATAACCCCTTTAACCTGCTAAGAATACCAGGATCAGTATCGAGAGAGGCTTCCGGCCTGGCAGAAGGGCGCTTTCCACCCACTCCCCCCCTGTTTAGTCCACCACCGAGACATCACTTGGACCCCCACCGCATAGAGCGCCTGGGGGCGGAAGAGATGGCCCTGGCCACCCATCACCCGAGTGCCTTTGACAGGGTGCTGCGGTTGAATCCAATGGCTATGGAGCCTCCCGCCATGGATTTCTCTAGGAGACTTAGAGAGCTGGCAGGGAACACGTCTAGCCCACCGCTGTCCCCAGGCCGGCCCAGCCCTATGCAAAGGTTACTGCAACCATTCCAGCCAGGTAGCAAGCCGCCCTTCCTGGCGACGCCCCCCCTCCCTCCTCTGCAATCCGCCCCTCCTCCCTCCCAGCCCCCGGTCAAGTCCAAGTCATGCGAGTTCTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000119866

numer dostępu NCBI

NM_018014

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... BCL11A(53335) , BCL11A(53335)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Chen-Han Zhang et al.
Oncotarget, 8(51), 88658-88669 (2017-11-29)
Tamoxifen resistance is a serious problem in the endocrine therapy of breast cancer. Long non-coding RNAs play important roles in tumor development. In this study, we revealed the involvement of lncRNA uc.57 and its downstream gene BCL11A in TAM resistance.
Samarwadee Plianwong et al.
Pharmaceutical research, 37(3), 46-46 (2020-02-06)
Short interfering RNA (siRNA) therapy promises a new era in treatment of breast cancers but effective delivery systems are needed for clinical use. Since silencing complementary targets may offer improved efficacy, this study was undertaken to identify non-viral carriers for
Alberto Daniel-Moreno et al.
Blood cells, molecules & diseases, 84, 102456-102456 (2020-06-05)
β-Hemoglobinopathies are among the most common single-gene disorders and are caused by different mutations in the β-globin gene. Recent curative therapeutic approaches for these disorders utilize lentiviral vectors (LVs) to introduce a functional copy of the β-globin gene into the
Petros Papadopoulos et al.
Human genomics, 14(1), 39-39 (2020-10-18)
The expression of the human β-like globin genes follows a well-orchestrated developmental pattern, undergoing two essential switches, the first one during the first weeks of gestation (ε to γ), and the second one during the perinatal period (γ to β).

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej