Przejdź do zawartości
Merck

EHU145511

Sigma-Aldrich

MISSION® esiRNA

targeting human STAG2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGCTATGCAGTCGGTGGTAGATGATTGGATAGAATCATACAAGCATGACCGAGATATAGCACTTCTTGACCTTATCAACTTTTTTATTCAGTGTTCAGGCTGTAAAGGAGTTGTCACAGCAGAAATGTTTAGACATATGCAGAACTCTGAGATAATTCGAAAAATGACTGAAGAATTCGATGAGGATAGTGGAGATTATCCACTTACCATGGCTGGTCCTCAGTGGAAGAAGTTCAAATCCAGTTTTTGTGAATTCATTGGCGTGTTAGTACGGCAATGTCAATATAGTATCATATATGATGAGTATATGATGGATACAGTCATTTCACTTCTTACAGGATTGTCTGACTCACAAGTCAGAGCATTTCGACATACAAGCACCCTGGCAGCTATGAAGTTGATGACAGCTTTGGTGAATGTGG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Gourish Mondal et al.
Nature communications, 10(1), 1686-1686 (2019-04-13)
Cohesin is a multiprotein ring that is responsible for cohesion of sister chromatids and formation of DNA loops to regulate gene expression. Genomic analyses have identified that the cohesin subunit STAG2 is frequently inactivated by mutations in cancer. However, the
Marianna Kleyman et al.
Journal of cell science, 127(Pt 19), 4225-4233 (2014-07-31)
Mutations in the STAG2 gene are present in ∼20% of tumors from different tissues of origin. STAG2 encodes a subunit of the cohesin complex, and tumors with loss-of-function mutations are usually aneuploid and display elevated frequencies of lagging chromosomes during
Yi Chen et al.
Molecular oncology, 14(5), 1101-1117 (2020-03-03)
Ewing sarcomas (ESs) are aggressive sarcomas driven by EWS fusion genes. We sought to investigate whether whole-transcriptome sequencing (RNA-seq) could be used to detect patterns associated with chemotherapy response or tumor progression after first-line treatment. Transcriptome sequencing (RNA-seq) of 13

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej