Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU145401

Sigma-Aldrich

MISSION® esiRNA

targeting human PGAM5

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCAGGAGGAGGACAGTTACGAGATCTTCATCTGTCACGCCAACGTCATCCGCTACATCGTGTGCAGCATCCCGCCGCTGTTGTCCGCTGGGGATTTTGTGCTTCTGGGGTCCTGACCTCTTTCACTTGCTGATCTGTGGGCGCTCCCACCCGTGTGCCAGCGTGACGGCTCGGGGTGTCCGCTCCCCTCTGGGTCGAGGCCACAGCTGAGTCACGTTGCTGCTCGGGCTGCTCCCTCGGGGGGCCCTTGTCCCTCAACCTGCTCTGGTGCCCCACTCTCAGCACCACAGAATGATCCGGGTTCAGGTTGCGTTTTCCCTGCCACCACCCTGCAATCAGCCACTTCTTTAAGGAGCTCCAGGGCTGCAGCCACGTTAGAGGGCCCCTTGGGGGGCAGGGCCAGCTCTACGGTTACATGCCTGAAACAGTCAGAAGGGTTGGCCAAATCTC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000176894

numer dostępu NCBI

NM_018663

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PGAM5(192111) , PGAM5(192111)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jeong-Min Hong et al.
Life sciences, 200, 94-104 (2018-03-11)
Heme oxygenase-1 (HO-1), an endogenous cytoprotective enzyme, is reported that can be localized in mitochondria under stress, contributing to preserve mitochondrial function. Mitochondrial quality control (QC) is essential to cellular health and recovery linked with redox homeostasis. Recent studies reported
Wei Zuo et al.
European journal of pharmacology, 880, 173143-173143 (2020-05-04)
Growing evidence have suggested that mitophagy could exert a neuroprotective role in brain ischemia by removing the damaged mitochondria. However the upstream mechanisms of mitophagy are remain unclear. We previously observed a decrease of miR-330 in a miRNA profile of
Chen Yang et al.
In vitro cellular & developmental biology. Animal, 53(3), 248-257 (2016-11-07)
Phosphoglycerate mutase 5 (PGAM5) is a mitochondrial membrane protein that plays crucial roles in necroptosis and apoptosis. Though PGAM5 is known to be required for inducing intrinsic apoptosis through interacting with BCL2 associated X protein (Bax) and dynamin-related protein 1
Yuhua Chen et al.
Antioxidants & redox signaling, 34(2), 154-170 (2020-04-08)
Aims: Traumatic brain injury (TBI) is a major cause of disability and death, and a better understanding of the underlying mechanisms of mitochondrial dysfunction will provide important targets for preventing damage from neuronal insults. Phosphoglycerate mutase 5 (PGAM5) is localized
Wei Lu et al.
Nature communications, 5, 4930-4930 (2014-09-16)
Mitophagy is a specialized form of autophagy that selectively disposes of dysfunctional mitochondria. Delineating the molecular regulation of mitophagy is of great importance because defects in this process lead to a variety of mitochondrial diseases. Here we report that mice

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej