Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU143531

Sigma-Aldrich

MISSION® esiRNA

targeting human SRGN

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GAGCACCCTGCTACATTTCCTAATCAAGAAGTTGGCGTGCAGCTGGGAGAGCTAGACTAAGTTGGTCATGATGCAGAAGCTACTCAAATGCAGTCGGCTTGTCCTGGCTCTTGCCCTCATCCTGGTTCTGGAATCCTCAGTTCAAGGTTATCCTACGCGGAGAGCCAGGTACCAATGGGTGCGCTGCAATCCAGACAGTAATTCTGCAAACTGCCTTGAAGAAAAAGGACCAATGTTCGAACTACTTCCAGGTGAATCCAACAAGATCCCCCGTCTGAGGACTGACCTTTTTCCAAAGACGAGAATCCAGGACTTGAATCGTATCTTCCCACTTTCTGAGGACTACTCTGGATCAGGCTTCGGCTCCGGCTCCGGCTCTGGATCAGGATCTGGGAGTGGCTTCCTAACGGAAATGGAACAGGATTACCAACTAGTAGACGAAAGTGATGCTTTCCATGACAACCTTAGGTCTCTTGACAGGAATCTGCCCTC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000122862

numer dostępu NCBI

NM_002727

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SRGN(5552) , SRGN(5552)

Powiązane kategorie

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Qinfeng Ma et al.
Molecular and cellular biochemistry, 474(1-2), 15-26 (2020-07-28)
Endothelial cells (ECs) play an important role in the pathogenesis of cardiovascular disease, especially atherosclerosis (AS). The abnormal wall shear stress (WSS) which directly contacts with ECs is the key stimulating factor leading to AS. However, the underlying mechanism of
Angela D'Ascola et al.
Biochemical and biophysical research communications, 499(3), 506-512 (2018-03-29)
Serglycin is expressed by a variety of cell types and mediates different functions in both normal and pathological conditions by interacting with different biological molecules, such as the CD44 receptor. Many studies suggest that serglycin has a crucial role in
Michele Scuruchi et al.
Archives of biochemistry and biophysics, 669, 80-86 (2019-05-31)
Serglycin (SRGN) is an intracellular proteoglycan produced and secreted by several cell types. The increased expression of SRGN was associated with greater aggressiveness in cancer and inflammation. In this study, we demonstrated that SRGN is increased in human chondrocytes after

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej