Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU141291

Sigma-Aldrich

MISSION® esiRNA

targeting human ABL1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGGCAAGCTCTACGTCTCCTCCGAGAGCCGCTTCAACACCCTGGCCGAGTTGGTTCATCATCATTCAACGGTGGCCGACGGGCTCATCACCACGCTCCATTATCCAGCCCCAAAGCGCAACAAGCCCACTGTCTATGGTGTGTCCCCCAACTACGACAAGTGGGAGATGGAACGCACGGACATCACCATGAAGCACAAGCTGGGCGGGGGCCAGTACGGGGAGGTGTACGAGGGCGTGTGGAAGAAATACAGCCTGACGGTGGCCGTGAAGACCTTGAAGGAGGACACCATGGAGGTGGAAGAGTTCTTGAAAGAAGCTGCAGTCATGAAAGAGATCAAACACCCTAACCTGGTGCAGCTCCTTGGGGTCTGCACCCGGGAGCCCCCGTTCTATATCATCACTGAGTTCATGACCTACGGGAACCTCCT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000097007

numer dostępu NCBI

NM_005157

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ABL1(25) , ABL1(25)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Remant Kc et al.
Stem cells and development, 28(11), 734-744 (2018-12-27)
Nonviral gene therapy with specific short interfering RNAs (siRNAs) against BCR-Abl can be an alternative and/or supportive therapy of chronic myeloid leukemia (CML) with tyrosine kinase inhibitors (TKIs), given the often observed resistance to TKIs in clinical setting. In this
Stephen D S McCarthy et al.
Journal of acquired immune deficiency syndromes (1999), 82(4), 407-415 (2019-10-29)
Previous studies support dasatinib as a potent inhibitor of HIV-1 replication. However, a functional distinction between 2 kinase targets of the drug, ABL1 and ARG, has not been assessed. We used primary CD4 T-cells, CD8-depleted peripheral blood mononuclear cells (PBMCs)
X Wang et al.
Scientific reports, 8(1), 1002-1002 (2018-01-19)
Exploration of human pulmonary artery endothelial cell (EC) as a prototypical biomechanical system has important pathophysiologic relevance because this cell type plays a key role in the development of a wide variety of clinical conditions. The complex hierarchical organization ranging
K C Remant et al.
Journal of biomedical materials research. Part A, 108(3), 565-580 (2019-11-13)
Synthetic siRNA technology has emerged as a promising approach for molecular therapy of cancer but, despite its potential for post-transcriptional gene silencing, there is an urgent need to develop efficient delivery systems particularly for difficult-to-transfect, anchorage-independent cells. In this study
Jun Hong et al.
Journal of Cancer, 11(20), 5867-5879 (2020-09-15)
Background: Esophageal adenocarcinoma (EAC) is highly aggressive and characterized by poor prognosis. AXL expression has been linked to Barrett's tumorigenesis and resistance to chemotherapy, which is associated with c-ABL intracellular localization. However, the molecular and functional relationship between AXL and
Wyświetl wszystkie powiązane dokumenty

Produkty

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej