Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU137391

Sigma-Aldrich

MISSION® esiRNA

targeting human RECQL4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TACGGCTCAACATGAAGCAGAAACACTACGTGCGGGGCCGGGCACTCCGTAGCAGGCTCCTCCGCAAGCAGGCATGGAAGCAGAAGTGGCGGAAGAAAGGGGAGTGTTTTGGGGGTGGTGGTGCCACAGTCACAACCAAGGAGTCTTGTTTCCTGAACGAGCAGTTCGATCACTGGGCAGCCCAGTGTCCCCGGCCAGCAAGTGAGGAAGACACAGATGCTGTTGGGCCTGAGCCACTGGTTCCTTCACCACAACCTGTACCTGAGGTGCCCAGCCTGGACCCCACCGTGCTGCCACTCTACTCCCTGGGGCCCTCAGGGCAGTTGGCAGAGACGCCGGCTGAGGTGTTCCAGGCCCTGGAGCAGCTGGGGCACCAAGCCTTTCGCCCTGGGCAGGAGCGTGCAGTCATGCGGATCCTGTCTGGCATCTCCAC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000160957

numer dostępu NCBI

NM_004260

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... RECQL4(9401) , RECQL4(9401)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Alvin J M Ng et al.
PLoS genetics, 11(4), e1005160-e1005160 (2015-04-11)
RECQL4 mutations are associated with Rothmund Thomson Syndrome (RTS), RAPADILINO Syndrome and Baller-Gerold Syndrome. These patients display a range of benign skeletal abnormalities such as low bone mass. In addition, RTS patients have a highly increased incidence of osteosarcoma (OS).
Guosheng Lyu et al.
Cancer biology & medicine, 18(1), 120-138 (2021-02-26)
RECQL4 (a member of the RECQ helicase family) upregulation has been reported to be associated with tumor progression in several malignancies. However, whether RECQL4 sustains esophageal squamous cell carcinoma (ESCC) has not been elucidated. In this study, we determined the
Chen Qiao et al.
Oncotarget, 7(13), 17009-17020 (2016-03-10)
Oroxylin A is a flavonoid extracted from the root of Scutellaria baicalensis Georgi. We previously demonstrated that oroxylin A induced apoptosis in human colon cancer cells via the mitochondrial pathway. In the present study, we investigated the underlying mechanisms responsible
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej