Przejdź do zawartości
Merck

EHU134591

MISSION® esiRNA

targeting human PDE4B

Zaloguj się, aby wyświetlić ceny organizacyjne i kontraktowe.

Wybierz wielkość


Informacje o tej pozycji

NACRES:
NA.51
UNSPSC Code:
41105324
Pomoc techniczna
Potrzebujesz pomocy? Nasz zespół doświadczonych naukowców chętnie Ci pomoże.
Pozwól nam pomóc
Pomoc techniczna
Potrzebujesz pomocy? Nasz zespół doświadczonych naukowców chętnie Ci pomoże.
Pozwól nam pomóc

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGGAAAGAGACCTCCTAAAGACATTCAGAATCTCATCTGACACATTTATAACCTACATGATGACTTTAGAAGACCATTACCATTCTGACGTGGCATATCACAACAGCCTGCACGCTGCTGATGTAGCCCAGTCGACCCATGTTCTCCTTTCTACACCAGCATTAGACGCTGTCTTCACAGATTTGGAGATCCTGGCTGCCATTTTTGCAGCTGCCATCCATGACGTTGATCATCCTGGAGTCTCCAATCAGTTTCTCATCAACACAAATTCAGAACTTGCTTTGATGTATAATGATGAATCTGTGTTGGAAAATCATCACCTTGCTGTGGGTTTCAAACTGCTGCAAGAAGAACACTGTGACATCTTCATGAATCTCACCAAGAAGCAGCGTCAGACAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PDE4B(5142)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Klasa składowania

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xue-Qi Liu et al.
Biochemical pharmacology, 180, 114132-114132 (2020-07-06)
Acute kidney injury (AKI), characterized by a rapid decline in renal function, is triggered by an acute inflammatory response that leads to kidney damage. An effective treatment for AKI is lacking. Using in vitro and in vivo AKI models, our
Dan Li et al.
International immunopharmacology, 90, 107176-107176 (2020-11-28)
Roflupram (ROF) is a novel phosphodiesterase 4 inhibitor. We previously found that ROF suppressed the production of pro-inflammatory factors in microglial cells; however, the underlying mechanisms are largely unknown. The present study aimed to elucidate the underlying molecular mechanisms of
Jiao Xiao et al.
Cellular and molecular neurobiology, 40(3), 421-435 (2019-10-30)
Tumor necrosis factor-α (TNF-α) is a critical pro-inflammatory cytokine regulating neuroinflammation. At high concentrations, it is toxic to neurons, and such damage is positively correlated with acute and chronic neurological diseases. Our previous studies showed that inhibition of phosphodiesterase 4
Ming-Yu Chen et al.
Bioengineered, 12(1), 708-719 (2021-02-02)
Reportedly, long non-coding RNA (lncRNA) are crucial modulators in neurodegenerative diseases. Herein, we investigated the role of lncRNA nuclear enriched abundant transcript 1 (NEAT1) in Parkinson's disease (PD). In-vitro PD model was established based on SH-SY5Y cells treated with 1-methyl-4-phenylpyridinium
Jiahong Zhong et al.
Free radical biology & medicine, 135, 87-101 (2019-03-01)
The etiology of Parkinson's disease (PD) is generally not well understood, but it is believed to involve excessive oxidative insult. Hence, identifying therapeutic targets and compounds that exhibit protective effects against oxidative damage is a reasonable strategy to slow down

Numer pozycji handlu globalnego

SKUNUMER GTIN
EHU134591-50UG04061828420940
EHU134591-20UG04061831364521

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej