Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU134461

Sigma-Aldrich

MISSION® esiRNA

targeting human TREM1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGATCTACCAGCCTCCCAAGGAGCCTCACATGCTGTTCGATCGCATCCGCTTGGTGGTGACCAAGGGTTTTTCAGGGACCCCTGGCTCCAATGAGAATTCTACCCAGAATGTGTATAAGATTCCTCCTACCACCACTAAGGCCTTGTGCCCACTCTATACCAGCCCCAGAACTGTGACCCAAGCTCCACCCAAGTCAACTGCCGATGTCTCCACTCCTGACTCTGAAATCAACCTTACAAATGTGACAGATATCATCAGGGTTCCGGTGTTCAACATTGTCATTCTCCTGGCTGGTGGATTCCTGAGTAAGAGCCTGGTCTTCTCTGTCCTGTTTGCTGTCACGCTGAGGTCATTTGTACCCTAGGCCCACGAACCCACGAGAATGTCCTCTGACTTCCAGCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000124731

numer dostępu NCBI

NM_018643

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TREM1(54210) , TREM1(54210)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiaoliang Zhang et al.
PloS one, 14(9), e0221991-e0221991 (2019-09-12)
This study aimed to examine the macrophage phenotype and its relationship to renal function and histological changes in human DN and the effect of TREM-1 on high-glucose-induced macrophage activation. We observed that in renal tissue biopsies, the expression of CD68
Danping Fan et al.
International journal of molecular sciences, 17(4), 498-498 (2016-04-07)
Triptolide (TP), an active component isolated from Tripterygiumwilfordii Hook F, has therapeutic potential against rheumatoid arthritis (RA). However, the underlying molecular mechanism has not been fully elucidated. The aim of this study is to investigate the mechanisms of TP acting
Jianfei Tang et al.
Biochemical and biophysical research communications, 482(4), 1240-1245 (2016-12-10)
Triggering receptor expressed on myeloid cells 1 (TREM-1) is a recently discovered molecule that modulates inflammatory responses. This study aimed to investigate the specific function of TREM-1 in chondrocytes and its association with the pathophysiology of osteoarthritis (OA). We observed
Mansoor Ali Syed et al.
American journal of respiratory cell and molecular biology, 60(3), 308-322 (2018-10-04)
Hyperoxia-induced injury to the developing lung, impaired alveolarization, and dysregulated vascularization are critical factors in the pathogenesis of bronchopulmonary dysplasia (BPD); however, mechanisms for hyperoxia-induced development of BPD are not fully known. In this study, we show that TREM-1 (triggering

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej