Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU133721

Sigma-Aldrich

MISSION® esiRNA

targeting human CASC2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych

Wybierz wielkość

20 μG
1060,00 zł
50 μG
1910,00 zł

1060,00 zł


Wysyłka zazwyczaj następuje w ciągu 3 tygodni (od 4 do 6 tygodni w przypadku zamówień niestandardowych).


Wybierz wielkość

Zmień widok
20 μG
1060,00 zł
50 μG
1910,00 zł

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

1060,00 zł


Wysyłka zazwyczaj następuje w ciągu 3 tygodni (od 4 do 6 tygodni w przypadku zamówień niestandardowych).

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CGGCAGATGGAGATTCAGAAACATAAGGACAACAAGAAACTTCCCCAAGGTATCATTATAGTCTTTAGACTTCAGACACACACCACACCTCAAATATATACACAACTGAAAGGAAAATTAAGGAAGTTTTTCAAAGAACCCTATTCCGAGTAAGAAGTGTGTTGCATGAATTTCTAAGAGCCAGAAAATGCATGACACAGGAGAAGATGTACCCTCATCTGTTCAGTGAGAGATGTGCAAATCAACATCAACACAGAACTGCTGAAGAAAAAAAATATGTCTCTGAAAAGCAACTTATTCACTGGAGATGTGAGGAGCCATCCGCACATCACAATTCTATAGACATCAAACGCATGAAGCATTTCGGATCTGCTTTAAGACTGAGGCAGACTTTCCATCTGGACACAGCCGACCATCCATGTGTCATTACAATGAATCCAGCACTTCCCTG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CASC2(255082)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Y X Dai et al.
Journal of biological regulators and homeostatic agents, 34(1), 49-56 (2020-03-07)
Dysregulation of lncRNA cancer susceptibility candidate 2 (CASC2) is involved in the pathogenesis of multiple malignancies. However, the underlying mechanisms by which lncRNA CASC2 regulates the proliferation of hemangiomas (HAs) remain undocumented. Herein, the expression levels of lncRNA CASC2 and
Yufeng Wang et al.
Molecular cancer, 16(1), 123-123 (2017-07-19)
Recently, it has been reported that long non-coding RNA (lncRNA) cancer susceptibility candidate 2 (CASC2), a novel tumor suppressor, participates in regulating the carcinogenesis and suppresses tumor progression by sponging microRNAs (miRNAs). However, the expression and function of CASC2 in
Chenjing Wang et al.
Molecular medicine (Cambridge, Mass.), 26(1), 74-74 (2020-07-24)
Studies have demonstrated that long noncoding RNAs (lncRNAs) have essential impacts on the development of atherosclerosis (AS). This study aimed to identify the role and functional mechanism of lncRNA CASC2 in the development and migration of vascular smooth muscle cells
Qi-Yu Liu et al.
The Kaohsiung journal of medical sciences, 37(4), 268-275 (2020-12-19)
Long noncoding RNA (lncRNA) Cancer Susceptibility 2 (CASC2) has been proved to contribute to the development of cancers. However, the mechanism behind the action of CASC2 in thyroid cancer is not quite clear. We demonstrated that CASC2 was downregulated in

Questions

Reviews

No rating value

Active Filters

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej