Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU131781

Sigma-Aldrich

MISSION® esiRNA

targeting human MUL1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGAAGCTCCAGGAAAATGCGTGCCTTATGCTGTTATAGAAGGAGCTGTGCGGTCTGTTAAAGAAACGCTTAACAGCCAGTTTGTGGAAAACTGCAAGGGGGTAATTCAGCGGCTGACACTTCAGGAGCACAAGATGGTGTGGAATCGAACCACCCACCTTTGGAATGATTGCTCAAAGATCATTCATCAGAGGACCAACACAGTGCCCTTTGACCTGGTGCCCCACGAGGATGGCGTGGATGTGGCTGTGCGAGTGCTGAAGCCCCTGGACTCAGTGGATCTGGGTCTAGAGACTGTGTATGAGAAGTTCCACCCCTCGATTCAGTCCTTCACCGATGTCATCGGCCACTACATCAGCGGTGAGCGGCCCAAAGGCATCCAAGAGACCGAGGAGATGCTGAAGGTGGGGGCCACCCTCACAGGGGTTGGCGAACTGGTCCTGGACAACAACTCTGTCCGCCT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000090432

numer dostępu NCBI

NM_024544

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MUL1(79594) , MUL1(79594)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yanfang Zhao et al.
Biochimica et biophysica acta, 1863(11), 2871-2881 (2017-08-08)
The pathogenesis of cardiac hypertrophy is tightly associated with mitochondrial dysfunction. Disequilibrium of mitochondrial dynamic is one of the main drivers in the pathological processes during development of various cardiac diseases. However, the effect of mitochondrial dynamics on cardiac hypertrophy
Sun-Yong Kim et al.
Oncotarget, 6(32), 33382-33396 (2015-10-10)
Recent research on non-thermal plasma (NTP, an ionized gas) has identified it as a novel cancer therapeutic tool. However, the molecular mechanism remains unclear. In this study, we demonstrated NTP induced cell death of head and neck cancer (HNC) through
Jina Yun et al.
eLife, 3, e01958-e01958 (2014-06-06)
Parkinson's disease (PD) genes PINK1 and parkin act in a common pathway that regulates mitochondrial integrity and quality. Identifying new suppressors of the pathway is important for finding new therapeutic strategies. In this study, we show that MUL1 suppresses PINK1
Rajat Puri et al.
Nature communications, 10(1), 3645-3645 (2019-08-15)
Chronic mitochondrial stress associates with major neurodegenerative diseases. Recovering stressed mitochondria constitutes a critical step of mitochondrial quality control and thus energy maintenance in early stages of neurodegeneration. Here, we reveal Mul1-Mfn2 pathway that maintains neuronal mitochondrial integrity under stress

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej