Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU128201

Sigma-Aldrich

MISSION® esiRNA

targeting human DEPDC1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GTTGCCATCGATGCTCTACAGTTATGTTGTTTGTTACTTCCCCCACCAAATCGTAGAAAGCTTCAACTTTTAATGCGTATGATTTCCCGAATGAGTCAAAATGTTGATATGCCCAAACTTCATGATGCAATGGGTACGAGGTCACTGATGATACATACCTTTTCTCGATGTGTGTTATGCTGTGCTGAAGAAGTGGATCTTGATGAGCTTCTTGCTGGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000024526

numer dostępu NCBI

NM_001114120

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... DEPDC1(55635) , DEPDC1(55635)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Alboukadel Kassambara et al.
PloS one, 8(4), e62752-e62752 (2013-05-07)
High throughput DNA microarray has made it possible to outline genes whose expression in malignant plasma cells is associated with short overall survival of patients with Multiple Myeloma (MM). A further step is to elucidate the mechanisms encoded by these
Anna Tosi et al.
Oncoimmunology, 6(8), e1313371-e1313371 (2017-09-19)
The identification of universal tumor-specific antigens shared between multiple patients and/or multiple tumors is of great importance to overcome the practical limitations of personalized cancer immunotherapy. Recent studies support the involvement of DEPDC1 in many aspects of cancer traits, such
Ryogo Kikuchi et al.
Journal of neuro-oncology, 133(2), 297-307 (2017-05-31)
DEP domain containing 1 (DEPDC1) is a novel oncoantigen expressed in cancer cells, which presents oncogenic activity and high immunogenicity. Although DEPDC1 has been predicted to be a useful antigen for the development of a cancer vaccine, its pathophysiological roles

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej