Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU125681

Sigma-Aldrich

MISSION® esiRNA

targeting human S100A4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GTCTTCCTGTCCTGCATCGCCATGATGTGTAACGAATTCTTTGAAGGCTTCCCAGATAAGCAGCCCAGGAAGAAATGAAAACTCCTCTGATGTGGTTGGGGGGTCTGCCAGCTGGGGCCCTCCCTGTCGCCAGTGGGCACTTTTTTTTTTCCACCCTGGCTCCTTCAGACACGTGCTTGATGCTGAGCAAGTTCAATAAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000196154

numer dostępu NCBI

NM_002961

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... S100A4(6275) , S100A4(6275)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Shasha Hou et al.
Laboratory investigation; a journal of technical methods and pathology, 98(8), 1025-1038 (2018-05-24)
As a member from S100 calcium-binding protein family, S100A4 is ubiquitous and elevated in tumor progression and metastasis, but its role in regulating obesity has not been well characterized. In this study, we showed that S100A4 was mainly expressed by
Xuelong Jiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 49(3), 1143-1162 (2018-09-10)
Anaplastic thyroid cancer (ATC), with 25% BRAFV600E mutation, is one of the most lethal human malignancies that currently has no effective therapy. Vemurafenib, a BRAFV600E inhibitor, has shown promise in clinical trials, including ATC patients, but is being hampered by
Giridhar Mudduluru et al.
Oncotarget, 8(13), 21081-21094 (2017-04-21)
The S100 calcium-binding protein A4 (S100A4) induces epithelial mesenchymal transition, migration, invasion, angiogenesis and metastasis. Its induced expression in several cancer types correlates with poor prognosis. Apart from the functional and transcriptional regulatory aspects of S100A4, its post-transcriptional regulation is
Andy Chen et al.
Scientific reports, 7(1), 3459-3459 (2017-06-16)
To investigate phenotypic and genotypic alterations before and after bone metastasis, we conducted genome-wide mRNA profiling and DNA exon sequencing of two cell lines (TMD and BMD) derived from a mouse xenograft model. TMD cells were harvested from the mammary
Ying Liu et al.
Cancer letters, 430, 1-10 (2018-05-08)
Our previous work has demonstrated that extracellular ATP is an important pro-invasive factor, and in this study, we tapped into a possible mechanism involved. We discovered that ATP could upregulate both the intracellular expression and secretion of S100A4 in breast
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej