Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU124091

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF5

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CATTCTTTCCACTGAATGCATAATGTTTAAATAGCATAAAATGAAATGCTACAAAAATTGAACTAATTTATACTTTAAAGTATTTCTGGGTTAAATGAAACAATGAAATTTTTTAGTATGTTCAACTCTCATCCAAATGGCATATGACCCTGTTTACACAGCCTAAAGCTAAAAATATTACTCTAGTTTATTCTAATCTATTGTTAAGTATTGTGCACTGTATACCAAGTTCTTAGGGCACATGAAAAATTTTAGCTGCCAAACAGGAACTAGTAAACATATGTTCCTAATAAGTGAAGGGAAAGATAATAATGATGGTCAACAATAAGCCACGTCAATGCATAAGTTGTATAGGCTAAATGTTGCTTGTAGGCTACATTAAACTCAAATGTAATAGTTTATCTTATACTCCTGGTTTGATTTGATTAGCA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Powiązane kategorie

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Sara Ghassemi et al.
Oncotarget, 8(50), 87750-87762 (2017-11-21)
Although FGF5 mRNA was previously found expressed in some melanoma cell lines in contrast to normal human melanocytes, neither its contribution to melanoma growth nor its expression in melanoma tissue has been investigated. Here we demonstrate that ectopic overexpression of
Zheng Zhu et al.
Oncology reports, 45(2), 501-512 (2021-01-09)
Hsa_circ_0016760 expression has been reported to be increased in non‑small cell lung cancer (NSCLC). The present study was designed to explore the role and mechanism of hsa_circ_0016760 in regulating NSCLC progression. In total, 60NSCLC patients were followed‑up for 60 months after surgery.
Yanjuan Zhou et al.
Journal of cellular biochemistry (2018-12-07)
The morbidity and mortality rates of nonsmall-cell lung cancer (NSCLC) have increased in recent years. We aimed to explore the biological role of fibroblast growth factor 5 (FGF5) in NSCLC. We first established that the expression of FGF5 was increased

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej