Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU122971

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF7

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCTACACGGAGGAACTGCTGCGGCACGTGGCCCCTGGGTTGCACCTGGAGCTTCGGGGGCCACAGCTGTGGGCCCGGCGCATGGGCAAGTGCAAGGTGTACTGGGAGGTGGGCGGACCCCCAGGCTCCGCCAGCCCCTCCACCCCAGCCTGCCTGCTGCCTCGGAACTGTGACACCCCCATCTTCGACTTCAGAGTCTTCTTCCAAGAGCTGGTGGAATTCCGGGCACGGCAGCGCCGTGGCTCCCCACGCTATACCATCTACCTGGGCTTCGGGCAGGACCTGTCAGCTGGGAGGCCCAAGGAGAAGAGCCTGGTCCTGGTGAAGCTGGAACCCTGGCTGTGCCGAGTGCACCTAGAGGGCACGCAGCGTGAGGGTGTGTCTTCCCTGGATAGCAGCAGCCTCAGCCTCTGCCTGTCCAGCGCCAACAGCCTCTATGACGACATCGAGTGCTTCCTTATGGAGC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000185507

numer dostępu NCBI

NM_001572

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... IRF7(3665) , IRF7(3665)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Rie Miyamoto et al.
Arthritis research & therapy, 12(3), R87-R87 (2010-05-18)
Plasmacytoid dendritic cells (pDCs) play not only a central role in the antiviral immune response in innate host defense, but also a pathogenic role in the development of the autoimmune process by their ability to produce robust amounts of type
Wenxin Wu et al.
Viruses, 12(4) (2020-04-03)
Influenza A virus (IAV) infection is a major cause of morbidity and mortality. Retinoic acid-inducible protein I (RIG-I) plays an important role in the recognition of IAV in most cell types, and leads to the activation of interferon (IFN). We
Kosuke Minaga et al.
Journal of gastroenterology, 55(5), 565-576 (2020-01-22)
Excessive type I IFN (IFN-I) production by plasmacytoid dendritic cells (pDCs) promotes autoimmunity. Recently, we reported that a prominent feature of both experimental autoimmune pancreatitis (AIP) and human type 1 AIP is pDC activation followed by enhanced production of IFN-I
Ying-Ying Xu et al.
Cancer research and treatment : official journal of Korean Cancer Association, 51(2), 576-592 (2018-07-22)
Although the interferon α (IFNα) signaling and the paired-like homeodomain transcription factor 2 (PITX2) have both been implicated in the progression of breast cancer (BCa), it remains obscure whether these two pathways act in a coordinated manner. We therefore aimed
N Ueno et al.
Oncogene, 36(31), 4481-4497 (2017-04-04)
We previously reported that PU.1 is downregulated in the majority of myeloma cell lines and primary myeloma cells of certain myeloma patients, and conditional expression of PU.1 in such myeloma cell lines induced cell cycle arrest and apoptosis. We found
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej