Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU115561

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM6A (1)

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CGTGTCGTATCAGCAGGAAATCTTCTAAGCCATGTTGGTCATACCATATTGGGCATGAACACAGTTCAACTATACATGAAAGTTCCAGGGAGCAGAACACCAGGTCATCAGGAAAATAACAACTTCTGTTCAGTTAACATAAATATTGGCCCAGGTGACTGTGAATGGTTTGTTGTTCCTGAAGGTTACTGGGGTGTTCTGAATGACTTCTGTGAAAAAAATAATTTGAATTTCCTAATGGGTTCTTGGTGGCCCAATCTTGAAGATCTTTATGAAGCAAATGTTCCAGTGTATAGGTTTATTCAGCGACCTGGAGATTTGGTCTGGATAAATGCAGGCACTGTTCATTGGGTTCAGGCTATTGGCTGGTGCAACAACATTGCTTGGAATGTTGGTCCACT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000147050

numer dostępu NCBI

NM_021140

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... KDM6A(7403) , UTX(7404)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hongya Han et al.
PloS one, 9(1), e85085-e85085 (2014-01-28)
Arachidonate 15-lipoxygenase-1 (ALOX15) oxygenates polyunsaturated fatty acids and bio-membranes, generating multiple lipid signalling mediators involved in inflammation. Several lines of evidence indicate that ALOX15 activation in the respiratory tract contributes to asthma progression. Recent experimental data reveals that histone modification
Hiroyuki Imuta et al.
Heart and vessels, 35(12), 1746-1754 (2020-07-18)
Macrophages play a crucial role in the development of atherosclerosis. To explore the mechanism by which macrophages attain a proinflammatory phenotype for a sustained period, we stimulated macrophages with lipopolysaccharide (LPS) and interferon-γ (IFN-γ) and measured the interleukin-1β (IL-1β) expression.
Shayesta Seenundun et al.
The EMBO journal, 29(8), 1401-1411 (2010-03-20)
Polycomb (PcG) and Trithorax (TrxG) group proteins act antagonistically to establish tissue-specific patterns of gene expression. The PcG protein Ezh2 facilitates repression by catalysing histone H3-Lys27 trimethylation (H3K27me3). For expression, H3K27me3 marks are removed and replaced by TrxG protein catalysed
Rintaro Hashizume et al.
Nature medicine, 20(12), 1394-1396 (2014-11-18)
Pediatric brainstem gliomas often harbor oncogenic K27M mutation of histone H3.3. Here we show that GSKJ4 pharmacologic inhibition of K27 demethylase JMJD3 increases cellular H3K27 methylation in K27M tumor cells and demonstrate potent antitumor activity both in vitro against K27M
Rakel Brendsdal Forthun et al.
PloS one, 7(11), e48992-e48992 (2012-11-17)
The mechanisms of successful epigenetic reprogramming in cancer are not well characterized as they involve coordinated removal of repressive marks and deposition of activating marks by a large number of histone and DNA modification enzymes. Here, we have used a
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej