Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU114171

Sigma-Aldrich

MISSION® esiRNA

targeting human FTH1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Vagisha Ravi et al.
PloS one, 14(9), e0221952-e0221952 (2019-09-07)
Elevated expression of the iron regulatory protein, ferritin heavy chain 1 (FTH1), is increasingly being associated with high tumor grade and poor survival outcomes in glioblastoma. Glioma initiating cells (GICs), a small population of stem-like cells implicated in therapeutic resistance
Katalin Éva Sikura et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(3), 413-431 (2019-02-01)
Objective- Calcific aortic valve disease is a prominent finding in elderly and in patients with chronic kidney disease. We investigated the potential role of iron metabolism in the pathogenesis of calcific aortic valve disease. Approach and Results- Cultured valvular interstitial
Caitlin W Brown et al.
Developmental cell, 51(5), 575-586 (2019-11-19)
Ferroptosis, regulated cell death characterized by the iron-dependent accumulation of lethal lipid reactive oxygen species, contributes to tissue homeostasis and numerous pathologies, and it may be exploited for therapy. Cells differ in their sensitivity to ferroptosis, however, and a key

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej