Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU107481

Sigma-Aldrich

MISSION® esiRNA

targeting human GBP1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCATCATCAGATCGTTGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATTCGAAACCAGGGGGCTATCGTCTCTTTGTTCAGAAGCTACAAGACCTGAAGAAAAAGTACTATGAGGAACCGAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTATGACTGATGCAATTCTCCAGACAGACCAGACTCTCACAGAAAAAGAAAAGGAGATTGAAGTGGAACGTGTGAAAGCTGAGTCTGCACAGGCTTCAGCAAAAATGTTGCAGGAAATGCAAAGAAAGAATGAGCAGATGATGGAACAGAAGGAGAGGAGTTATCAGGAACACTTGAAACAACTGACTGAGAAGATGGAGAACGACAGGGTCCAGTTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000117228

numer dostępu NCBI

NM_002053

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... GBP1(2633) , GBP1(2635)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Kun Zhang et al.
Oncotarget, 8(18), 30422-30437 (2017-04-19)
H5N1 avian influenza viruses are a major pandemic concern. In contrast to the highly virulent phenotype of H5N1 in humans and many animal models, guinea pigs do not typically display signs of severe disease in response to H5N1 virus infection.
J Song et al.
European review for medical and pharmacological sciences, 24(10), 5465-5472 (2020-06-05)
Non-small cell lung cancer (NSCLC) is one of the most ordinary cancers worldwide. Recent studies have discovered many oncogenes play vital roles in the tumorigenesis of malignant tumors. The purpose of our study was to uncover the role of GBP1
Ichiko Yamakita et al.
Biochemical and biophysical research communications, 518(2), 266-272 (2019-08-20)
Previously, we identified molecules involved in human invasive lung adenocarcinoma, and guanylate-binding protein 1 (GBP-1) was selected for further analysis. RT-PCR of normal lung and invasive lung adenocarcinoma tissue samples showed that the relative GBP-1 expression levels normalized to GAPDH
Arda Halu et al.
eLife, 7 (2018-10-12)
The role of pro-inflammatory macrophage activation in cardiovascular disease (CVD) is a complex one amenable to network approaches. While an indispensible tool for elucidating the molecular underpinnings of complex diseases including CVD, the interactome is limited in its utility as
Motoi Fukumoto et al.
Cancer science, 105(10), 1351-1359 (2014-08-08)
Standard fractionated radiotherapy for the treatment of cancer consists of daily irradiation of 2-Gy X-rays, 5 days a week for 5-8 weeks. To understand the characteristics of radioresistant cancer cells and to develop more effective radiotherapy, we established a series

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej