Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU107281

Sigma-Aldrich

MISSION® esiRNA

targeting human ESRRA

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCGCTGTCTGACCAGATGTCAGTACTGCAGAGCGTGTGGATGGAGGTGCTGGTGCTGGGTGTGGCCCAGCGCTCACTGCCACTGCAGGATGAGCTGGCCTTCGCTGAGGACTTAGTCCTGGATGAAGAGGGGGCACGGGCAGCTGGCCTGGGGGAACTGGGGGCTGCCCTGCTGCAACTAGTGCGGCGGCTGCAGGCCCTGCGGCTGGAGCGAGAGGAGTATGTTCTACTAAAGGCCTTGGCCCTTGCCAATTCAGACTCTGTGCACATCGAAGATGCCGAGGCTGTGGAGCAGCTGCGAGAAGCTCTGCACGAGGCCCTGCTGGAGTATGAAGCCGGCCGGGCTGGCCCCGGAGGGGGTGCTGAGCGGCGGCGGGCGGGCAGGCTGCTGCTCACGCTACCGCTCCTCCGCCAGACAGCGGGCAAAGTGCTGGCCCATTTCTATGGGGTGAAGCTGGAGGGCAAGGTGCCCATGCACAAGCTGTTCTTGGAGATGCTCGAGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000173153

numer dostępu NCBI

NM_004451

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ESRRA(2101) , ESRRA(2101)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiumin Huang et al.
Cell adhesion & migration, 12(6), 538-547 (2018-05-22)
Estrogenic signals have been suggested to be important for the tumorigenesis and progression of endometrial cancer (EC) cells. Our present data showed that estrogen related receptor alpha (ERRα), while not ERRβ or ERRγ, was significantly elevated in EC cells and
Peng Chen et al.
Journal of cellular biochemistry, 118(1), 74-81 (2016-05-28)
Curcumin has demonstrated valuable therapeutic potential against a variety of human cancers including osteosarcoma. However, the molecular mechanisms underlying its anti-tumor effect remain to be poorly understood. By RNA sequence profiling, we found that curcumin significantly down-regulates the expression of
Kaori Yoriki et al.
Scientific reports, 9(1), 6697-6697 (2019-05-02)
Estrogen-related receptor alpha (ERRα), which shares structural similarities with estrogen receptors, is associated with tumor progression in endometrial cancer, but little is known about the detailed underlying mechanism. We investigated whether ERRα, in cooperation with peroxisome proliferator-activated receptor gamma coactivator
Ankana Tiwari et al.
Scientific reports, 5, 17621-17621 (2015-12-08)
The ESRRA gene encodes a transcription factor and regulates several genes, such as WNT11 and OPN, involved in tumorigenesis. It is upregulated in several cancers, including OSCC. We have previously shown that the tumor suppressor miR-125a targets ESRRA, and its

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej