Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU106621

Sigma-Aldrich

MISSION® esiRNA

targeting human SUMO1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCAAAGACAGGGTGTTCCAATGAATTCACTCAGGTTTCTCTTTGAGGGTCAGAGAATTGCTGATAATCATACTCCAAAAGAACTGGGAATGGAGGAAGAAGATGTGATTGAAGTTTATCAGGAACAAACGGGGGGTCATTCAACAGTTTAGATATTCTTTTTATTTTTTTTCTTTTCCCTCAATCCTTTTTTATTTTTAAAAATAGTTCTTTTGTAATGTGGTGTTCAAAACGGAATTGAAAACTGGCACCCCATCTCTTTGAAACATCTGGTAATTTGAATTCTAGTGCTCATTATTCATTATTGTTTGTTTTCATTGTGCTGATTTTTGGTGATCAAGCCTCAGTCCCCTTCATATTACCCTCTCCTTTTTAAAAATTACGTGTGCACAGAGAGGTCACCTTTTTCAGGACATTGCATTTTCAGGC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000116030

numer dostępu NCBI

NM_003352

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SUMO1(7341) , SUMO1(7341)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
XZU

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yufeng Yao et al.
Pulmonary pharmacology & therapeutics, 55, 38-49 (2019-02-01)
Pulmonary arterial hypertension (PAH) is a life-threatening disease without effective therapies. PAH is associated with a progressive increase in pulmonary vascular resistance and irreversible pulmonary vascular remodeling. SUMO1 (small ubiquitin-related modifier 1) can bind to target proteins and lead to
Sabine Hergovits et al.
Journal of cellular and molecular medicine, 21(11), 3087-3099 (2017-06-01)
Interleukin (IL)-6-type cytokines have no direct antiviral activity; nevertheless, they display immune-modulatory functions. Oncostatin M (OSM), a member of the IL-6 family, has recently been shown to induce a distinct number of classical interferon stimulated genes (ISG). Most of them
Lin-Nan Zhu et al.
Frontiers in cellular neuroscience, 12, 262-262 (2018-09-11)
Methamphetamine (METH) is an illegal and widely abused psychoactive stimulant. METH abusers are at high risk of neurodegenerative disorders, including Parkinson's disease (PD). Previous studies have demonstrated that METH causes alpha-synuclein (α-syn) aggregation in the both laboratory animal and human.
Dao-Ying Yuan et al.
Oncology reports, 38(4), 2360-2368 (2017-08-10)
Radiotherapy is one of the most effective non-surgical treatments for oral squamous cell carcinoma. However, radioresistance remains a major impediment to radiotherapy. Although BetA (Betulinic acid) can induce radiosensitization, the underlying mechanism and whether it could induce radiosensitization in oral

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej