Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU100071

Sigma-Aldrich

MISSION® esiRNA

targeting human NUAK1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCATCACCACAAGCACAACTTGAAGCACCGCTACGAGCTGCAGGAGACCCTGGGCAAAGGCACCTACGGCAAAGTCAAGCGGGCCACCGAGAGGTTTTCTGGCCGAGTGGTTGCTATAAAATCCATTCGTAAGGACAAAATTAAGGATGAACAAGACATGGTTCACATCAGACGAGAGATTGAGATCATGTCATCTCTCAACCATCCTCATATCATCAGTATTTATGAAGTGTTTGAGAACAAAGATAAGATTGTGATCATCATGGAATATGCCAGCAAAGGGGAGCTGTACGATTACATCAGTGAGCGGCG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000074590

numer dostępu NCBI

NM_014840

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... NUAK1(9891) , NUAK1(9891)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Minghui Li et al.
American journal of translational research, 9(4), 1708-1719 (2017-05-05)
Lung cancer incidence and mortality rates are amongst the highest of all malignant tumors worldwide. ARK5 is a member of the human AMP-activated protein kinase (AMPK) family which is implicated in tumor survival and progression. The current study was designed
Ji Kui Peng et al.
Oncology letters, 15(3), 3639-3645 (2018-02-23)
Hypoxia is a common characteristic of solid tumors. Previous studies have reported that the tumor invasion-associated factor, AMPK-related protein kinase 5 (ARK5), is associated with a poor prognosis in colon cancer. However, whether or not ARK5 is involved in hypoxia
Emilia Escalona et al.
Frontiers in oncology, 10, 1123-1123 (2020-08-06)
NUAK1 is an AMPK-related kinase located in the cytosol and the nucleus, whose expression associates with tumor malignancy and poor patient prognosis in several cancers. Accordingly, NUAK1 was associated with metastasis because it promotes cell migration and invasion in different
Martin Golkowski et al.
Cell systems, 11(2), 196-207 (2020-08-07)
Hepatocellular carcinoma (HCC) is a complex and deadly disease lacking druggable genetic mutations. The limited efficacy of systemic treatments for advanced HCC implies that predictive biomarkers and drug targets are urgently needed. Most HCC drugs target protein kinases, indicating that
Giacomo Cossa et al.
Molecular cell, 77(6), 1322-1339 (2020-02-02)
Deregulated expression of MYC induces a dependence on the NUAK1 kinase, but the molecular mechanisms underlying this dependence have not been fully clarified. Here, we show that NUAK1 is a predominantly nuclear protein that associates with a network of nuclear

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej