Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU093121

Sigma-Aldrich

MISSION® esiRNA

targeting human CTTN

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTTGGGAAGGAAGGCAGTGCCTGCTCTGCTGTGAGCCGCCAGGAACCCTCCTCCTGTCAATGGGGGTGTAGTATTTTTGCCAAAATATCATGTTCAATTTCAGTAGTTTGATCAGTTGAAGGCTAGAAGTGTGAAGTGCAGATGAGTGTGTGTTCTTCCCCAAGGTCCCCCCACAGCTCCAGGACACCGCTGTCCTGGCATTTGTGGCCACTCACTTTGTAGGAAACTCATCTCCTTCCTGAGGAGCCGGGAGGCTGGACCAGTCCCGTCGTGCAGTCAGGTGGGCGGTGTGTCTTTCCAGAAGGTCACGTGGAAATGTCTCGGGACTTGGGTCCCGGAGTGCCCGTGAAGCGTGTTTTTGCTCCTGAGGTGCATTTTCTCATCATCCTTGCTTTACCACAATGAGCAATGAGGTCGGGTTTTA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000085733

numer dostępu NCBI

NM_138565

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CTTN(2017) , CTTN(2017)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiaojian Zhang et al.
Oncotarget, 8(1), 1541-1554 (2016-12-03)
Cortactin (CTTN) is overexpressed in various tumors, including head and neck squamous cell carcinoma and colorectal cancer (CRC), and can serve as a biomarker of cancer metastasis. We observed that CTTN promotes cancer cell proliferation in vitro and increases CRC
Rachel J Watkins et al.
The Journal of clinical endocrinology and metabolism, 101(12), 4551-4563 (2016-09-08)
Metastatic disease is responsible for the majority of endocrine cancer deaths. New therapeutic targets are urgently needed to improve patient survival rates. The proto-oncogene PTTG1-binding factor (PBF/PTTG1IP) is overexpressed in multiple endocrine cancers and circumstantially associated with tumor aggressiveness. This
Steven M Markwell et al.
Molecular cancer research : MCR, 17(4), 987-1001 (2019-01-06)
Malregulation of the actin cytoskeleton enhances tumor cell motility and invasion. The actin-binding protein cortactin facilitates branched actin network formation through activation of the actin-related protein (Arp) 2/3 complex. Increased cortactin expression due to gene amplification is observed in head
Dominik Horn et al.
Head & neck, 40(12), 2685-2694 (2018-11-21)
Cortactin (CTTN) is located on chromosome 11q13 and is associated with invasiveness in various cancer entities. CTTN protein expression could be a prognosticator of oral squamous cell carcinoma (OSCC) in terms of recurrence and survival. CTTN-dependent invasion was performed using
Xuan Liang et al.
Nature communications, 8(1), 790-790 (2017-10-07)
Contractile adherens junctions support cell-cell adhesion, epithelial integrity, and morphogenesis. Much effort has been devoted to understanding how contractility is established; however, less is known about whether contractility can be actively downregulated at junctions nor what function this might serve.
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej