Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU090371

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGCACGTACACAGCCCTAATCATAGCTACAGACAATGGTTCTCCAGTTGCTACTGGAACAGGGACACTTCTGCTGATCCTGTCTGATGTGAATGACAACGCCCCCATACCAGAACCTCGAACTATATTCTTCTGTGAGAGGAATCCAAAGCCTCAGGTCATAAACATCATTGATGCAGACCTTCCTCCCAATACATCTCCCTTCACAGCAGAACTAACACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAACCCAAGAATCTATCATTTTGAAGCCAAAGATGGCCTTAGAGGTGGGTGACTACAAAATCAATCTCAAGCTCATGGATAACCAGAATAAAGACCAAGTGACCACCTTAGAGGTCAGCGTGTGTGACTGTGAAGGGGCCGCTGGCGTCTGTAGGAAGGCACAGCCT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Stanowią one heterogeniczną mieszaninę siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także wyświetlić wszystkie dostępne opcje esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Anchalee Techasen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(9), 8645-8652 (2014-05-29)
Tumor progression is characterized by loss of cell adhesion and increase of invasion and metastasis. E-cadherin, a cell adhesion molecule, is frequently downregulated and has been proposed as an important mediator in epithelial-mesenchymal transition (EMT) in tumors. In this study
Branka Petrić Miše et al.
Pathology oncology research : POR, 21(2), 347-356 (2014-08-12)
To analyze correlation between immunoexpression of E-cadherin and efficacy of first line platinum-based chemotherapy in patients with advanced-stage high-grade serous ovarian carcinoma. The expression of E-cadherin was analyzed immunohistochemically in formalin-fixed, paraffin-embedded samples from 98 patients with advanced-stage high-grade serous
Vikas Bhardwaj et al.
Oncotarget, 6(3), 1531-1543 (2015-01-22)
H. pylori infection is the strongest known risk factor for gastric cancer. Inhibition of host tumor suppressor mechanisms by the bacteria underlies the development of this disease. Among the tumor suppressors affected by H. pylori are p53 and E-cadherin, which
Shuai Xiao et al.
Digestive diseases and sciences, 60(4), 910-918 (2014-11-05)
Epithelial-mesenchymal transition (EMT) plays an important role in hepatocellular carcinoma (HCC) dissemination. Bromodomain PHD-finger transcription factor (BPTF) could regulate embrogenesis and stem cell differentiation, and it may be involved in tumor progression and EMT. In this study, we aimed to
Alex Chernyavsky et al.
International immunopharmacology, 29(1), 76-80 (2015-05-24)
The mechanism of detachment and death of keratinocytes in pemphigus vulgaris (PV) involves pro-apoptotic action of constellations of autoantibodies determining disease severity and response to treatment. The presence of antibodies to nicotinic acetylcholine receptors (nAChRs) and the therapeutic efficacy of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej