Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU088911

Sigma-Aldrich

MISSION® esiRNA

targeting human GCNT2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGGCCCAGGAGATCAGTAATTACAAATTAAGGGTTAAATCAGAGATTATTCAACAGAGAGGGAGAAAGGAGGAGACAGAGGGAGGACCTGTTGTGTTCCAGCCATTCTGGTATTCCTTTATGTATCTAATTTCATTCAAACCTCACAACAGTCTTGTGAGGCCCTTATATAATTACTCCCATTTTGCAGATGAAGTAACTGAGGCTTAGAAAGGTTAATAGCACCGGGGAACAATTTCTCTGGGTGAGAATTGGGACTCTGTTGCTGGTCTTCTCAGTTCATTTCCTGAGGTGGATTTACTGAGAGAAGGTGAAATAAAGCCATATTTAGTATACCAGAGAAGGTAGATTTTAAGAATGGTCTCAGTGTTAATACTGAGAAAAAGTCCTGTCAGTTCAG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000111846

numer dostępu NCBI

NM_145649

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... GCNT2(2651) , GCNT2(2651)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

N Giovannone et al.
Nature communications, 9(1), 3287-3287 (2018-08-19)
Leukocytes are coated with a layer of heterogeneous carbohydrates (glycans) that modulate immune function, in part by governing specific interactions with glycan-binding proteins (lectins). Although nearly all membrane proteins bear glycans, the identity and function of most of these sugars
Caitlin J Bowen et al.
Developmental biology, 407(1), 145-157 (2015-07-19)
Proper remodeling of the endocardial cushions into thin fibrous valves is essential for gestational progression and long-term function. This process involves dynamic interactions between resident cells and their local environment, much of which is not understood. In this study, we
Tomas Baldassarre et al.
Molecular cancer research : MCR, 13(6), 1044-1055 (2015-03-19)
Triple-negative breast cancers (TNBCs) are highly aggressive cancers that lack targeted therapies. However, EGFR is frequently activated in a subset of TNBCs and represents a viable clinical target. Because the endocytic adaptor protein Endophilin A2 (SH3GL1/Endo II) has been implicated
Zheren Shao et al.
PloS one, 10(7), e0132655-e0132655 (2015-07-24)
Melanomas cause over 76% of skin cancer deaths annually. Phosphatidylinositol 3-kinase (PI3K)-AKT-mammalian target of rapamycin (mTOR) signaling pathway is important for melanoma initiation and progression. In the current study, we evaluated the potential anti-melanoma effect of VS-5584, a novel and
Alexandre K Rouquette-Jazdanian et al.
PloS one, 10(6), e0131823-e0131823 (2015-06-30)
Linker for Activation of T cells (LAT) is an adapter protein that is essential for T cell function. Knock-in mice with a LAT mutation impairing calcium flux develop a fatal CD4+ lymphoproliferative disease. miR-155 is a microRNA that is correlated

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej