Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU087831

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM29

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCATGGATGCTCTGGATGAGAGAGCCAAGGTGCTGCATGAGGACAAGCAGACCCGGGAGCAGCTGCATAGCATCAGCGACTCTGTGTTGTTTCTGCAGGAATTTGGTGCATTGATGAGCAATTACTCTCTCCCCCCACCCCTGCCCACCTATCATGTCCTGCTGGAGGGGGAGGGCCTGGGACAGTCACTAGGCAACTTCAAGGACGACCTGCTCAATGTATGCATGCGCCACGTTGAGAAGATGTGCAAGGCGGACCTGAGCCGTAACTTCATTGAGAGGAACCACATGGAGAACGGTGGTGACCATCGCTATGTGAACAACTACACGAACAGCTTCGGGGGTGAGTGGAGTGCACCGGACACCATGAAGAGATACTCCATGTACCTGACACCCAAAGGTGGGGTCCGGACATCATACCAGCCCTCGTC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jing Han et al.
Aging, 13(4), 5034-5054 (2021-01-27)
Targeted molecular therapy is the most effective treatment for cancer. An effective therapeutic target for colorectal cancer (CRC) is urgently needed. However, the mechanisms of CRC remain poorly understood, which has hampered research and development of CRC-targeted therapy. TRIM29 is
Phillip L Palmbos et al.
Cancer research, 75(23), 5155-5166 (2015-10-17)
Bladder cancer is a common and deadly malignancy but its treatment has advanced little due to poor understanding of the factors and pathways that promote disease. ATDC/TRIM29 is a highly expressed gene in several lethal tumor types, including bladder tumors
Yasushi Masuda et al.
Nature communications, 6, 7299-7299 (2015-06-23)
Although DNA double-strand break (DSB) repair is mediated by numerous proteins accumulated at DSB sites, how DNA repair proteins are assembled into damaged chromatin has not been fully elucidated. Here we show that a member of the tripartite motif protein

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej