Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU085701

Sigma-Aldrich

MISSION® esiRNA

targeting human APP

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTCGTTCCTGACAAGTGCAAATTCTTACACCAGGAGAGGATGGATGTTTGCGAAACTCATCTTCACTGGCACACCGTCGCCAAAGAGACATGCAGTGAGAAGAGTACCAACTTGCATGACTACGGCATGTTGCTGCCCTGCGGAATTGACAAGTTCCGAGGGGTAGAGTTTGTGTGTTGCCCACTGGCTGAAGAAAGTGACAATGTGGATTCTGCTGATGCGGAGGAGGATGACTCGGATGTCTGGTGGGGCGGAGCAGACACAGACTATGCAGATGGGAGTGAAGACAAAGTAGTAGAAGTAGCAGAGGAGGAAGAAGTGGCTGAGGTGGAAGAAGAAGAAGCCGATGATGACGAGGACGATGAGGATGGTGATGAGGTAGAGGAAGAGGCTGAGGAACCCTACGAAGAAGCCACAGAGAGAACCACCAGCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000142192

numer dostępu NCBI

NM_201414

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... APP(351) , APP(351)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Bruce X Wong et al.
PloS one, 9(12), e114174-e114174 (2014-12-03)
Ceruloplasmin is a ferroxidase that interacts with ferroportin to export cellular iron, but is not expressed in neurons. We recently reported that the amyloid precursor protein (APP) is the analogous iron-exporting chaperone for neurons and other cells. The ferroxidase activity
Changyi Ji et al.
Cellular and molecular neurobiology, 38(4), 941-954 (2017-11-28)
Iron efflux in mammalian cells is mediated by the ferrous iron exporter ferroportin (Fpn); Fpn plasma membrane localization and function are supported by a multicopper ferroxidase and/or the soluble amyloid precursor protein (sAPP). Fpn and APP are ubiquitously expressed in
Nathalie Pierrot et al.
EMBO molecular medicine, 5(4), 608-625 (2013-04-05)
Perturbation of lipid metabolism favours progression of Alzheimer disease, in which processing of Amyloid Precursor Protein (APP) has important implications. APP cleavage is tightly regulated by cholesterol and APP fragments regulate lipid homeostasis. Here, we investigated whether up or down
Livius V d'Uscio et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 38(10), 1715-1726 (2017-09-30)
The exact physiological function of amyloid-β precursor protein (APP) in endothelial cells is unknown. Endothelium-specific APP-deficient (eAPP-/-) mice were created to gain new insights into the role of APP in the control of vascular endothelial function. Endothelium-dependent relaxations to acetylcholine
Cindy M Sondag et al.
Journal of neuroinflammation, 7, 22-22 (2010-03-23)
Amyloid precursor protein (APP) is a ubiquitously expressed cell surface protein reported to be involved in mediating cell-cell or cell-matrix interactions. Prior work has demonstrated that APP co-localizes with beta1 integrin in different cell types. In an effort to determine
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej