Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU084551

Sigma-Aldrich

MISSION® esiRNA

targeting human STMN1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TACACTGCCTGTCGCTTGTCTTCTATTCACCATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAGGCTTTTGAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCCCCTCCAAAGAAGAAGGATCTTTCCCTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAAGAAAGACGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCTGGCTGAGAAACGAGAGCACGAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAAATGGCTGCCAAACTGGAACGTTTGCGAGAGAAGGATAAGCACATTGAAGAAGTGCGGAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000117632

numer dostępu NCBI

NM_203401

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... STMN1(3925) , STMN1(3925)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Pinjie Bao et al.
Annals of surgical oncology, 24(13), 4017-4024 (2017-09-22)
Known as a microtubule-destabilizing protein, STMN1 (gene symbol: STMN1) regulates the dynamics of microtubules, cell cycle progress, and chemo-resistance against taxane agents. It is highly expressed in various human cancers and involved in cancer progression as well as poor prognosis.
C M Fife et al.
Oncogene, 36(4), 501-511 (2016-06-21)
Neuroblastoma, the most common solid tumor of young children, frequently presents with aggressive metastatic disease and for these children the 5-year survival rates are dismal. Metastasis, the movement of cancer cells from one site to another, involves remodeling of the
Valerie B Sampson et al.
Oncotarget, 7(52), 86594-86607 (2016-11-20)
Osteosarcoma is the most frequently occurring bone cancer in children and adolescents. Unfortunately, treatment failures are common. Eribulin is a synthetic microtubule inhibitor that has demonstrated activity in preclinical osteosarcoma models. The effects of eribulin were evaluated in two human
Deepmala Shrestha et al.
Journal of cellular biochemistry, 119(2), 2381-2395 (2017-09-09)
Stathmin/oncoprotein18 regulates microtubule dynamics and participates in mitotic entry and exit. We isolated stathmin as a physically interacting partner of KIFC1, a minus-end-directed kinesin functioning in bipolar spindle formation and maintenance. We found that stathmin depletion leads to multipolar spindle
Long-Xian Lv et al.
Oncotarget, 8(16), 26992-27006 (2017-05-04)
Hispidin and its derivatives are widely distributed in edible mushrooms. Hispidin is more cytotoxic to A549, SCL-1, Bel7402 and Capan-1 cancer cells than to MRC5 normal cells; by contrast, hispidin protects H9c2 cardiomyoblast cells from hydrogen peroxide-induced or doxorubicin-induced apoptosis.
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej